Construction And Identification Of Co-expression Recombinant Plasmid Of Blood Type A Antigen Mimicry Polypeptide/Fas Fusion Gene And Mip3β

Background:According to the World Health Organization's latest report, there are about 14 million cancer patients,and 2 million new cancer patients and 5 million death each year. Among the died people,one of ten was died of cancer. Cancer is one of the three major causes of death, only behind Cardio-cerebrovascular disease and the accident. Cancer is the first or second leading of death in the developed country. NCI, the authority of the United States, reports that there is an upward trend in the cancer incidence, and that cancer mortality has increased from 16% to 23% in the past twenty years .Experts predict that the morbidity and moratlity of cancer will continue to increase primarily due to an aging population, smoking, lifestyle changes and the process of industrialization in the next twenty or thirty years. Of course, Cancer is a very complicated process.Most of previous cancer researches focus on tumor cells themselves, trying to explain the development of neoplasm from the angle of cancer cells'genes and phenotypes.with the devepment of genetic and molecular biology, it was found that occurrence and progression of cancer is related to both cancer cells and tumor microenvironment. Tumor microenvironment which is the environment where tumor cells develop, is composed of the tumor cells, the stromal cells,capillaries,tissue fluids and a few infiltrating cells, such as dendritic cells, macrophages and so on. There is a complex relationship between the microenvironment and tumor cells. They interact and reflect change and even reserse the biological characteristics of tumors. They have an important imfluence on Epigenetics of tumor,stem cells, immune escaption, metastasis potential etc. the antitumor effect downregulation of immune cells which infiltrate in tumor microenvironment, are conducive to the progression of malignant tumor, the formation of new blood vessels and transfer metastasis to particular part when its anti-tumor effect down. How to upregulate the microenvironment's antitumor effect is an important way to treat tumor.With a long history, surgery, radiotherapy and chemotherapy are three conventional methods in the treatment of cancer.A hundred years ago,with bacteria vaccine immuning body, Caley observed that tumors turned to be smaller. Then people realized that the tumor may trigger the response of immune, and the body's immune system also has surveillance function to tumor. The antitumor immunity, including native and aquired, plays an important role in immune surveilance and antitumor effect. As further research on basic immune, people have a deeper understanding on the recognition on tumor and the mechanism of tumor from immune surveillance .That tumor cell as an antigen cause immune response needs two activation signals. First, the antigen presenting cell (APCs) captures and processes tumor antigen with MHC-I peptide or MHC-Ⅱpeptide to CD8 or CIM T lymphocytes. Second,that the high levels of total stimulus molecules (B7-1, ICAM-1, LFA-1, etc) which APCs express, combine with surface receptor (CD28, TJFA-1, CD2, etc) on antigen specific T lymphocyte,and then trigger the response of body anti-tumor cellular immune. According to the body's immune monitoring and tumor antigen expression, tumor will cause the response of immune to inhibit its growth in malignant transformation and process of transferring in theory. So, cancer immunotherapy is gained more and more attentions. Adoptive cell immunotherapy was considered the most promising immune therapy. This method is that culture patient's immune cells in vitro by adding tumor specific antigen and cell stimulatory factors, screen the immune cells which have highly specific effect to kill cancer and amplify largely, and then back them to the patients' bodies to kill tumor. This method overcomes two key problems, one is the low presenting efficiency of tumor antigen as the tolerance of tumor immune, the other is the shortage of effect lymphocyte.By using this method, studies in vitro can obtain better effect to kill cancer, but effect was far inferior in vivo.It can't get significant immune killer effect in vivo. Because the tumor cells not only can evade the immune system's attack passively, but also actively inhibit the normal function of the immune cells in the environment it grow in. Recent studies show that immune tolerance of tumor microenvironment is the most key reasons for that. There are many factors to lead to immune tolerance in the local tumor microenvironment. and their mechanisms are also different, Mainly:Obstacle function of local effects cell, Inhibitory immune adjustment cell Treg,the negative immune regulatory role of cytokines, the inhibitory reaction of ligands and receptor, the negative adjustment of T cell's metabolic activity in tumor microenvironment etc. Currently, there isn't good solution in ameliorating immune tolerance in tumor microenvironment.Due to tumor microenvironment in immunocompromised states, the immune system can not effectively submit tumor antigen, so it cannot start the tumor specific immune process, and activate the immune effect cells. It is those reasons that how to activate the immune, and rebuild the body's immune reaction process, make T cells which can specificly identify tumor cell antigen proliferate, differentiate to kill cancer cells are the key of cancer immunotherapy. Because of clinical application of tumor cell vaccine, there are certain technical difficulties at present .People turn to inject gene vaccine directly in the tumor cancer, especially with the non-virus vector as plasmid vector carrying the target gene. The principle of Gene vaccine treating cancer is to combine genes encoding tumor specific antigens with vector using engineering technology, then inject it directly into the body, express expected antigen with carrier itself and gene expression system, and then induce specific cells immune response. How to select the targeted cancer genes encoding related antigen and how to effectively guarantee the expression of the purpose gene in the body, are the key to the research on cancer gene vaccine. That the immunogenicity of tumor antigens decline in body causes specificity cellular immune activation insufficient and immune tolerance situation.According to that, the design strategy of cancer vaccine is to enhance the recognition ability of immune system to tumor antigen, ameliorate immune microenvironment, cause strong specificity anti-tumor cellular immunity, prevent cancer progression and eventually eliminate tumors with the application of various technology.The current range of tumor therapy methods cann't improve immune function in tumor microenvironment inhibited state well.People still haven't found a better way to break the tumor inhibitory effect of environment on immune cells. We are enlightened by the fact of acute rejection after organ transplantation. The donor organizations antigen antibody is pre-existent in recipients. They can combine together with the antigens and activate the complement system which can effectively kill tumor cells. The active complement system can also cause inflammatory response, and then cause the thrombosis. Irreversible necrosises of tumors will happan because of ischemia.Blood antigen can cause strong anti-blood group immune response, and can inspire and increase the function of the body's specific and nonspecific immune. Blood group antigens are a class of allogenic antigen which has strong immunogenicity and antigenicity. If we introduce anti-blood immune response in local tumor, that may enhance the body's specific and non-specific immune function, but also may improve local tumor immunosuppression, and promote DC present tumor antigen to stimulate CTL activity in killing tumor cells. This study was designed based on this idea.We design the experiment including 2 parts.(1) Screening of the clone of Blood type A antigen mimicry polypeptide(2) Construction and identification of Blood type A antigen mimicry polypeptide-Mip3βdouble expression recombinant plasmidPart one Screening of the clone of Blood type A antigen mimicry polypeptideObjective:To screen the clone of Blood type A antigen mimicry polypeptide and obtain the masculine clone.Methods:Using phage random 12-mer peptide library according to the directions and make ELISA experiment to identify the masculine clone and sequence. The masculine clone was identified by using phage random 12-mer peptide library according to the directions and ELISA experiment,and then sequenced.Result:The sequencing result:CCTAACCACAGCCCTAAAAGCCTTAGAATCCACATA .The amino acid sequence is YVD-SKA-FRA-VVR.Conclusion:we are successful in screening the clone of Blood type A antigen mimicry polypeptide, and we obtain the masculine clone gene. Part two Construction and identification of co-expression recombinant plasmid of Blood type A antigen mimicry polypeptide/Fas fusion gene and Mip3pObjective:Construction and identification of co-expression recombinant plasmid of Blood type A antigen mimicry polypeptide/Fas fusion gene and Mip3p. Methods:Mip3βgene was amplified with RT-PCR, and constructed into the mammalian co-expression plasmid vector pIRES (MCS B). Then inserted fusion gene in the mammalian co-expression plasmid pIRES (MCS A)Result: Blood type A antigen mimicry polypeptide-Mip3βdouble expression recombinant plasmid was successfully obtained.Conclusion:Blood type A antigen mimicry polypeptide -Mip3βdouble expression recombinant plasmid was successfully obtained.