Pine blight, caused by Pestalotiopsis funerea Desm, is one usual and main disease in coniferous forest. Needle Cast Disease of Spruce is caused by Rhizosphaera kalkhoffii Bubak and often broke up in Shangrila and west of Sichuan. In this study, a quick and effiecnt detection method for Pestalotiopsis funerea Desm and Rhizosphaera kalkhoffii Bubak was seek as a reference for forest disease quick diagnosis and detecion.Based on the application of ITS sequence in rDNA to fungous taxon, seven pairs of primers for Pestalotiopsis funerea Desm were designed. And one optimal primer was named AF with the following sequence:F(5’-3’):GTCAACCAGCGGAGGGAT18bpR(5’-3’):CGCCGTTGTATTTCAGGAG19bpMeanwhile, six pairs of primers for Rhizosphaera kalkhoffii Bubak were designed along with one optimal primer named EU2with the following sequence:F(5’-3’):CCAACCAAACTCTTGTATTAA21bpR(5’-3’):GGGTATCCCTACCTGATCCGA21bpIn the molecular detection of pine blight’s pathogenetic fungi, Pestalotiopsis funerea Desm was not found in P.densata, Parmandi, P.massoniana and P.yunnanensis before March,2011. Pestalotiopsis funerea Desm was not only detected in specimen of P.massoniana in Shixiang Lake and leaf apex and middle part of P.yunnanensis in Erlang Mountain in March,2011, but also detected in foliar base of P.yunnanensis in Erlang Mountain. In the molecular detection of Needle Cast Disease of Spruce, specimens were collected seven times all over the year around. Rhizosphaera kalkhoffii Bubak was not found in needle of spruce in Erlang Mountain until July,2011. And August was the most suitable period for detection. The PCR product of pathogenetic fungi was sequenced and verified as the very pathogenetic fungi after a BLAST in GenBank.Results showed it was practicable to detect pine blight and Needle Cast Disease of Spruce with a molecular method based on known ITS sequnece of Pestalotiopsis funerea Desm and Rhizosphaera kalkhoffii Bubak in GenBank. With this method, pathogenetic fungi of Pestalotiopsis funerea Desm could be detected about two months ahead of the schedule which suggested needle failing of spruce in Eralng Mountain was caused by Rhizosphaera kalkhoffii Bubak not Lophodermium piceae(Fuckel)V.Hohn. And Rhizosphaera kalkhoffii Bubak was found in needle tissue of P.likiangensis and P.asperata.This molecular detection method could detect the exist of pathogenetic fungi very qucikly and accurately. It provided important basis for forest disease detection, prevention and control. |