| 1. IntroductionProstate cancer (PCa) remains the most commonly diagnosed malignancy and is one of the leading factors causing tumor related death in males. Prostate cancer accouts for25%, the highest mobidity, of all newly diagnosed cancers in America in2009[1]. Currently, treatments of prostate cancer include radical prostatectomy, radiotherapy, endocrine treatments, chemotherapy.In patients in early stage, radiotherapy can cure prostate cancer as radical prostatectomy. In patients with locally advanced or high-risk local prostate cancer, addition of local radiotherapy to endocrine treatment can decreased overall mortality [2]. As patients with matastasis, local symptoms can be relieved by radiotherapy, followed by improvement of quality of life. However, recurrence and poor prognosis in many prostate cancer patients was always found because prostate cancer cells can easily become radio-resistant [3]. Higher radiation doses (>70Gy) could improve radiotherapy effect but with increased toxicity to neighboring normal tissue [4]. Hormonal deprivation is a sensitizing strategy, however long-term hormonal deprivation might induce hormone-resistant prostate cancer cells with radiation resistance [5]. So, how to improve radiation-sensitivity and hormone-sensitivity is a hot issue.The oligosaccharides are crucial to cell differentiation, adhension, proliferation, and tumor invasion, and metastasis [6]. The production and alteration of oligosaccharides are catalyzed by glucosaminyltransferase. More and more evidences demonstrate that the gene of glucosaminyltransferase can directly influence the phenotype of carcinoma cells and tissues [6][7]. N-acetylglucosaminyltransferase V (GnT-V), located in the Golgi apparatus, is a key enzyme in the formation of β1-6branching of asparagine (N)-linked oligosaccharides. A variety of studies have shown that GnT-V is strongly linked to carcinoma proliferation, invasion, and metastasis [8][9][10]. GnT-V was reported to be over-expressing in many malignant tumors, such as breast cancer, colon cancer, and hepatocarcinoma [11][12][13]. These responses are performed mainly through the oligosaccharides modulation, resulting in activation of EGFR cell signal, inhibiton of proteasome degradation and E-cadherin/β-cateninn complex function [14][15][16].Although the roles of GnT-V in many tumors have been studied, the relationship between GnT-V and PCa has not been reported. The role of GnT-V in radiation sensitivity and hormone sensitivity of PCa was concerned in our experiments. Furthermore, the possible underlying mechanisms were also studied.2. Materials and methods2.1. Cell culture and transfectionThe prostate cancer cell line Lncap was provided by the cell bank of Sun Yat-Sen University. The cells were maintained in RPMI-1640and supplemented10%fetal bovine serum. All cells were incubated at37℃in a humidified atmosphere containing5%CO2.The pGPU6/GFP/Neo vector was obtained from Shanghai GenePharma Co, Ltd. The pGPU6/GFP/Neo GnT-V/1079(plasmid of antisense GnT-V cDNA), pGPU6/GFP/Neo GnT-V/1564(plasmid of antisense GnT-V cDNA) and pGPU6/GFP/Neo GnT-V/NC (control plasmid) were constructed as described previously. The constructed plasmids were transfected into Lncap cells by Lipofectamine2000TM (Invitrogen, California, USA). The stable transfectants were selected in RPMI-1640containing G418at600μg/ml, and named as Lncap GnT-V/NC, Lncap GnT-V/1079and Lncap GnT-V/1564, respectively.PC3was provided by the cell bank of Sun Yat-Sen University. PC3GnT-V/NC, PC3GnT-V/1564, and PC3GnT-V/1079were constructed in our previous experiments. The cells were cultured in RPMI-1640containing10%fetal bovine serum at37℃, with5%CO2.2.2. QRT-PCRTotal RNA was harvested from cell and tumor tissue using Trizol (Invitrogen, California, USA). Levels of GnT-V mRNA were detected by Quantitative Real Time Reverse Transcription-PCR analysis (qRT-PCR). Reverse transcription reactions were proceed for15min at37℃, followed by5s at85℃for complementary DNA (cDNA) synthesis. Real time reactions were performed using the SYBR(?) PrimeScriptTM RT-PCR Kit (Takara Biotechnology Co, Ltd) under the following conditions:30s at95℃for1cycle,5s at95℃,34s at64℃for40cycles,95℃for0s,63℃for60s, and95℃for0s for melting curve analysis. The PCR primers (Shanghai SangonBiotech Co, Ltd) were as follows:GnT-V F:5’GAGCAGATCCTGGACCTCAG3’; R:5’GCTGTCATGACTCCAGCGTA3’; GAPDH F:5’AGAAGGCTGGGGCTCATTTG3’; R:5’AGGGGCCATCCACAGTCTTC3’. The relative mRNA expression level of GnT-V in each sample was calculated using the comparative expression level2-△△Ct method.2.3. Western blotCells were harvested and lysed with cold RIPA buffer. Protein concentration of the supernatant was determined by the BCA protein assay procedure. The proteins were prepared with loading buffer and heated at100℃for5minutes. All the samples were run on8-15%Tris-Glycine gels. Semi-dry transfers were performed for an hour at80mA using polyvinylidene difluoride membranes. After being blocked with5%fat-free dry milk, the membrane was incubated overnight at4℃with primary antibodies(1:200-diluted antibody of GnT-V,1:200-diluted antibody of bax, and1:200-diluted antibody of bcl-2,1:200-diluted antibody of bcl-xl, all from Santa Cruz Biotechnology, Inc, California, USA), followed by incubation with horseradish peroxidase-labeled secondary antibody (Beijing Biosynthesis Biotechnology Co, Ltd) for an hour at room temperature, and then stained with ECL reagent. Protein bands were quantified by Image-Pro Plus6.0software. 2.4. Clonogenic Survival AssayCells were plated in six-well plates and radiated with photons (0,2,4,6, and8Gy) using a linear accelerator (Clinac2300C/D; Varian, United States). Incubated at37℃with5%CO2for21days, the cells were stained with0.1%crystal violet for colony counting. Only colony containing more than50cells was scored.2.5. Cell Counting Kit-8(CCK-8) AssayTo clarify the role of GnT-V in radiation sensitivity of Lncap cell line, cells were plated in96-well plates (5000cells/well) and radiated with a single dose of6Gy. At different times (0,24,48,72, and96h) following radiation,10μl cck-8solution and100μl RPMI1640were added to each well. The cells were incubated for1-2h before reading the absorbency using a micro-plate reader at450nm.To study the role of GnT-V in hormone-sensitivity in prostate cancer cell lines Lncap and PC3. Cells were plated in96-well plates and treated with different concentration of flutamide (Oumol/h10umol/l、20umol/l、50umol/l、100umol/l). After72hours, the cells were washed with phosphate buffered saline (PBS), and10μl cck-8solution plus100μl RPMI1640were added to each well. The cells were incubated for1-2h before reading the absorbency using a micro-plate reader at450nm.2.6. Scratch AssayCells were plated in6-well plates and incubated till100%confluence was observed. A1mm linear "scratch" was made with a200μL pipette tip and cells were radiated with a single dose of6Gy. Linear distance between cells on either side of the scratch was measured in9locations for each well at0,12,24and48hours.2.7. Cell Apoptosis AssayCells were plated in six-well plates and radiated with doses of OGy and6Gy. Seventy-two hours after radiation, the morphological alterations of apoptotic cells were observed by fluorescence microscopy using Hoechst33258staining.Cells were plated in six-well plates and radiated with doses of OGy and6Gy. Floating and attached cells were harvested at72h post-radiation. The cells were washed with PBS, and resuspended in binding buffer, followed by the addition of Annexin V-PE and7-AAD for10minutes. Cell apoptosis analysis was carried out using a flow cytometer (BD Biosciences, Oxford, United Kingdom).2.8. Caspase-3Activity AssayCaspase-3activity was assayed using the caspase-3colorimetric assay kit (Beyotime, China) according to the manufacturer’s instructions. Cells were radiated with single dose of6Gy. After24,48and72h, the protein was extracted and diluted with cell lysis buffer. The reaction buffer (80μl) was added to each sample (10ul). The10μl AC-DEVD-pNA substrate was added to the mixture and incubated at37℃for1-2hours. Samples were read at405nm in a micro-plate reader.2.9. Cell Cycle AnalysisLncap cells were plated in six-well plates and radiated with four single radiation doses (0,2,6, and10Gy). Floating and attached cells were harvested at24h post-radiation, then cells were fixed in70%ethanol at4℃overnight. After being washed with PBS, the cells were treated with RNase. Next,50μg/ml PI was added for30min followed by flow cytometry analysis of cell cycle (BD Biosciences, Oxford, United Kingdom).2.10. In vivo Tumorigenicity AssaysForty-eight male nude mice (five weeks old, weighing18-20g, from the Animal Experimental Center, Guangdong Academy of Medical Sciences, China) were used in the following assays in vivo. The mice were raised under specific pathogen-free conditions. Animal experiments were performed under the regulations of the institutional ethical commission (Southern Medical University).Cells were harvested, washed with PBS and resuspended in PBS. Forty-eight nude mice were randomly divided into three groups for Lncap, Lncap GnT-V/NC, and Lncap GnT-V/1079cells, respectively. Cells (5×106) in PBS were subcutaneously inoculated into the legs of nude mice to establish the tumor model, respectively. Tumors were measured in two dimensions with calipers and the volumes were estimated using the following calculation:(major axis)×(minor axis)×(minor axis)×1/2. Radiation was delivered to tumors during consecutive5days (2Gy×5) using a linear accelerator as described previously when the tumor volume reached to200-300mm3. Growth curves of the tumors after radiation were constructed. Twenty-one days later,6mice of each group were sacrificed and tumors were excised. Furthermore, expression of GnT-V in tumors from each group was detected by qRT-PCR, western blot assay and immunohistochemistry. Expression of bcl-2, bax, and bcl-xl proteins in tumors were detected by western blot assay and immunohistochemistry. The other10mice of each group were used to carry out a survival study. Survival rates were recorded and a survival curve was constructed.2.11. Immunohistochemical AnalysisThe harvested tumors from each group described previously were embedded in paraffin after they were placed in10%formalin for24hours. Paraffin slides were deparaffinized in xylene, and rehydrated in graded ethanol. The tissues were rinsed twice with PBS, and endogenous peroxidase was blocked using3%hydrogen peroxide for5min. The tissues were washed with PBS and blocked for10min at room temperature with animal non-immune serum. The tissue was incubated at4℃overnight with primary antibodies(1:200-diluted antibody of GnT-V,1:200-diluted antibody of bax,1:200-diluted antibody of bcl-2, and1:200-diluted antibody of bcl-xl, all from Santa Cruz Biotechnology, Inc, California, USA), followed by incubated with secondary antibody for30min at room temperature, and then stained with DAB solution. Finally, the tissues were counterstained with hematoxylin, dehydrated, and mounted with Permount. The tissues were observed under the microscope.2.12. Luciferase AssaysTo investigate whether inhibition of GnT-V enhance the radiation-sensitivity through NF-kB cell signal, cells were plated in24-well plates, transfected with pNF-kB-Luciferase plasmid (from Peter MacCallum Cancer Centre) plus pRL-CMV plasmid (from Peter MacCallum Cancer Centre) using lipofectin (Invitrogen) and exposed to6Gy. Luciferase and Renilla signals were measured0h,6h after radiation using the Dual Luciferase Reporter Assay kit (Promega, USA) according to a protocol provided by the manufacturer.To address the question whether inhibition of GnT-V enhanced the hormone-sensitivity mediated WNT cell signal, cells were plated in24-well plates, transfected with pWNT-Luciferase plasmid (from Peter MacCallum Cancer Centre) plus pRL-CMV plasmid (from Peter MacCallum Cancer Centre) using lipofectin (Invitrogen) and treated with10umol/l flutamide. Luciferase and Renilla signals were measured72h post-treatment using the Dual Luciferase Reporter Assay kit (Promega, USA) according to a protocol provided by the manufacturer.2.13. Statistical AnalysisData were analyzed using SPSS13.0software. Results are presented using means±SD. Comparison of means between two samples was performed using Student’s t test. Statistical comparisons of more than two groups were performed using one-way analysis of variance (ANOVA), and then multiple comparisons were performed using least-significant difference (LSD). In all cases, P<0.05was considered statistically significant.3. Results3.1. Development of Lncap cells inhibition GnT-VAfter being screened for one month under G418(600ug/ml), cells containing the recombinant plasmids were harvested by fluorescence microscopy (Fig.1).The expression of GnT-V mRNA in Lncap GnT-V/1079and Lncap GnT-V/1564cells were decreased by74%and64.3%compared with Lncap, respectively by qRT-PCR. The GnT-V protein in Lncap GnT-V/1079and Lncap GnT-V/1564cells compared with Lncap was decreased by68.7%and54.7%respectively by western blot (Fig.2, Table.1). It was confirmed that the expression of GnT-V at both the mRNA and protein level in Lncap GnT-V/1079and Lncap GnT-V/1564cells were decreased when compared with the control groups of Lncap cells and Lncap GnT-V/NC cells.3.2. Inhibition of GnT-V decreases clonogenic survivalSurvival fraction of Lncap GnT-V/1079was lower than those of the control groups of Lncap and Lncap GnT-V/NC, while similar to that of Lncap GnT-V/1564after radiation (Fig.3, Table.2), which indicated inhibition of GnT-V enhanced the radiation sensitivity of Lncap cells. 3.3. Inhibition of GnT-V sensitizes Lncap cells to radiation, resulting in decreased cell viabilityLncap GnT-V/1079and Lncap GnT-V/1564showed a significant reduction of cell viability at all four time points (24,48,72, and96h) following radiation compared with Lncap and Lncap GnT-V/NC. There was no significant difference in cell viability after radiation between Lncap GnT-V/1079and Lncap GnT-V/1564. This data suggesting that targeted inhibition of GnT-V could sensitize Lncap cells to radiation, resulting in decreased cell viability (Fig.4, Table.3).3.4. Inhibition of GnT-V downregulates motility ofPCa cellsThe movement of Lncap GnT-V/1079and Lncap GnT-V/1564were more slowly than those of the control groups at different time points (12,24and48h) post-radiation. There was no significant difference in cell migration after radiation between Lncap GnT-V/1079and Lncap GnT-V/1564(Fig.5A, Table.4). The similar results were found in PC3, PC3GnT-V/NC, PC3GnT-V/1079and PC3GnT-V/1564cells (Fig.5B, Table.5). All these results suggested that inhibition of GnT-V enhanced the radiation-sensitivity, leading to downregulation of migration in PCa cells.According to the results of Clonogenic survival assay, CCK-8assay and scratch assay described previously, there was no significant difference between Lncap GnT-V/1079and Lncap GnT-V/1564in cell viability, survival fractions and motility. Besides, pGPU6/GFP/Neo GnT-V/1079plasmid reduced the GnT-V mRNA and protein expression more efficiently than pGPU6/GFP/Neo GnT-V/1564plasmid. So, Lncap GnT-V/1079cells were chosen for the further assays.3.5. Inhibition of GnT-V increases radiation-induced apoptosisApoptotic morphology, characterized as nuclear condensation and fragmentation, could be observed in Lncap GnT-V/1079cells using fluorescence microscopy before and after radiation. However, apoptotic morphology was only observed in Lncap and Lncap GnT-V/NC cells after radiation, and the apoptosis rates were much lower than those of Lncap GnT-V/1079group by Hoechst33258staining (Fig.6A).The apoptosis rates in Lncap GnT-V/NC and Lncap GnT-V/1079were (1.30±0.26)%and (3.15±0.56)%before radiation,(9.66±0.73)%and (12.38±0.82)%at72h after radiation by flow cytometer (Fig.6B, Table.6). There was only about8.36%difference in apoptosis rates between Lncap GnT-V/NC and Lncap GnT-V/1079before radiation, and the difference was further amplified after radiation. Taken together, these data indicated that inhibition of GnT-V increased radiation-induced apoptosis in vitro.3.6. Inhibition of GnT-V increases radiation-induced caspase-3activityCaspase-3activity of Lncap GnT-V/1079was higher than those of Lncap and Lncap GnT-V/NC at all three time points (24,48, and72h) following radiation (Table.7). It was confirmed that down-regulation of GnT-V might increase caspase-3activity, which was related with Lncap radiation sensitivity.3.7. Inhibition of GnT-V decreases radiation-induced G2/M phase arrestA dose-dependent G2/M arrest was observed in Lncap GnT-V/NC cells after radiation, while this phenomenon could not be observed in Lncap GnT-V/1079cells.(Fig.7, Table.8) This finding suggests that down-regulation of GnT-V could result in decreased radiation-induced G2/M phase arrest.3.8. Inhibition of GnT-V decreases radiation-induced NF-kB transcriptionNF-κB transcriptional activity in Lncap GnT-V/1079was lower than those in Lncap and Lncap GnT-V/NC before radiation, and this phenomenon was magnified6h post radiation. However, the difference between the two control groups had no statistical significance no matter before or after radiation (Fig.8A, Table.9). The similar findings occurred in PC3, PC3GnT-V/NC and PC3GnT-V/1079cells (Fig.8B, Table.10).All the results indicated that inhibition of GnT-V sensitized PCa cells to radiation via blocking NF-kB cell signal.3.9. Inhibition of GnT-V enhances Lncap radiation sensitivity in vivo.The growth of Lncap GnT-V/1079tumors was significantly slowly compared with those of Lncap and Lncap GnT-V/NC tumors (Figure.9A-B). The mean normalized tumor size were (1.121±0.090) mm3in Lncap group,(1.116±0.082) mm3in Lncap GnT-V/NC and (0.882±0.065) mm3in Lncap GnT-V/1079following lOGy radiation (Table.11).The Lncap xenograft nude mice from Lncap GnT-V/1079treated with radiation showed longer survival times compared with the control groups of Lncap and Lncap GnT-V/NC (Fig.10).3.10. Inhibition of GnT-V sensitizes cells to radiation-induced apoptosis via regulating expression of bcl-2family proteins in vitro and in vivo.The bax protein expression in Lncap GnT-V/1079was higher than those in Lncap and Lncap GnT-V/NC whether before or after radiation by western blot. Furthermore, the expression of bax protein was higher in Lncap GnT-V/1079after radiation than before radiation. However, the expression of bax protein in Lncap and Lncap GnT-V/NC were unchanged before and after radiation. The results indicated that inhibition of GnT-V might induce expression of bax protein directly and radiation could further increase expression of bax protein.The expression of bcl-2protein in Lncap GnT-V/1079was lower than those in Lncap and Lncap GnT-V/NC no matter before or after radiation by western blot. Moreover, the bcl-2protein expression in Lncap and Lncap GnT-V/NC were reduced by radiation, and this response was magnified in Lncap GnT-V/1079. The results indicated that inhibition of GnT-V might reduce expression of bcl-2protein directly and radiation could result in the greater reduction of bcl-2protein.No significant difference of bcl-xl protein was found between control groups and Lncap GnT-V/1079by western blot. In addition, the bcl-xl protein remained unaltered in Lncap, Lncap GnT-V/NC and Lncap GnT-V/1079after radiation compared with before radiation. Suppression of GnT-V might have no effect on bcl-xl.(Fig.11A, Table,12)Moreover, in vivo studies, the increased bax and decreased bcl-2in Lncap GnT-V/1079after radiation can be confirmed by western blot and immunohistochemisty (Fig.11B-C).3.11. Inhibition of GnT-V sensitizes PCa cells to hormone therapy, resulting in decreased cell viability.Lncap GnT-V/1079showed a significant reduction of cell viability after treatment with different concentration of flutamide(10umol/1、20umol/l、50umol/l、100umol/l) compared with Lncap and Lncap GnT-V/NC. There was no significant difference in cell viability after hormone therapy between Lncap and Lncap GnT-V/NC (Fig.12A, Table,13). The similar results were observed between PC3, PC3GnT-V/NC and PC3GnT-V/1079(Fig.12B, Table,14). All these data suggested that targeted inhibition of GnT-V could enhance endocrine therapy sensitivity of PCa cells, resulting in decreased cell viability.3.12. Inhibition of GnT-V sensitizes PCa cells to hormone therapy via regulating expression of bcl-2family proteins.The bax protein expression in Lncap GnT-V/1079was higher than those in Lncap and Lncap GnT-V/NC whether before or after treatment with flutamide by western blot. Furthermore, the difference between expression of bax protein before and after treatment in Lncap GnT-V/1079was more significant than those of Lncap and Lncap GnT-V/NC. The results indicated that inhibition of GnT-V might induce expression of bax protein directly and hormone therapy could result in the greater induction of bax protein.The expression of bcl-2protein in Lncap GnT-V/1079was lower than those in Lncap and Lncap GnT-V/NC no matter before or after treatment with flutamide by western blot. Moreover, the difference between expression of bcl-2protein before treatment and after treatment in Lncap GnT-V/1079was more significant than those of Lncap and Lncap GnT-V/NC. The results indicated that inhibition of GnT-V might reduce expression of bcl-2protein directly and hormone therapy could result in the greater reduction of bcl-2protein.No significant difference of bcl-xl protein was found between control groups and Lncap GnT-V/1079by western blot. In addition, the bcl-xl protein remained unaltered in Lncap, Lncap GnT-V/NC and Lncap GnT-V/1079after endocrine therapy compared with before endocrine therapy. Suppression of GnT-V might have no effect on bcl-xl.(Fig.13A, Table,15)Similar results were found between PC3, PC3GnT-V/NC and PC3GnT-V/1079(Fig.13B, Table,16). All these data suggested that targeted inhibition of GnT-V could increase bax/bcl-2, resulting in improvement of endocrine therapy sensitivity in PCa cells. 3.13. Inhibition of GnT-V enhances hormone-sensitivity of PCa cells via blocking WNT cell signal.WNT transcriptional activity in Lncap GnT-V/1079was lower than in Lncap and Lncap GnT-V/NC before treatment with10umol/l flutamide, and this phenomenon was magnified72h after treatment. However, the difference between the two control groups had no statistical significance no matter before or after treatment (Fig.14A, Table,17). The similar findings occurred in PC3, PC3GnT-V/NC and PC3GnT-V/1079cells (Fig.14B, Table,18). All the results indicated that inhibition of GnT-V sensitized PCa cells to hormone therapy via downregulation of WNT transcription activity.Conclusion:1、The shRNA expression vectors aimed at GnT-V gene can inhibit the expression of GnT-V both in the level of mRNA and protein obviously.2、Inhibition of GnT-V can enhance radiosensitivity of human prostate cancer cell in vitro and in vivo.3、The potential mechanism by which inhibition of GnT-V enhanced radiation sensitivity may be associated with blocking of radiation-induced NF-kB transcription, followed by suppression of bcl-2and up-regulation of Bax that led to increased caspase-3activity, and disruption of radiation-induced G2/M arrest.4、Inhibition of GnT-V can enhance hormone-sensitivity of human prostate cancer cell Lines Lncap and PC3.5、The potential mechanism by which inhibition of GnT-V enhanced hormone-sensitivity may be associated with blocking WNT cell signal, which resulted in up regulation Bax/bcl-2.6、GnT-V may be a potential target for increasing radiation sensitivity and hormone sensitivity of prostate cancer. |
PDF Full Text Request