DNA Barcoding Common Medicinal Snakes In South China And Its Application In Identification Of Jinqian Baihua She (Bungarus Parvus)

As a great treasure of China, Traditional Chinese medicine has been used for thousands of years in treating diseases. Animal drug is an important part of Chinese medicine. A total of553kinds of medicinal materials are recorded in Chinese Pharmacopoeia, including53kinds of animal drugs which accounting for9.6%. Besides, animal drugs recorded in Chinese Pharmacopoeia only accounts for3.2%of the available resources for medicinal animals. The snakes are mainly used as medicine, food, and the snake skin is used as leather. For example, common species for medicinal use include Ptyas mucosus, Zaocys dhumnades, Bungarus multicinctus, Deinagkistrodon acutus, etc.; Ptyas korros, P. mucosus, Naja atra are that for edible use; Elaphe carinata is used in leather making. It is worthy to be metioned that B. multicinctu, Z. dhumnades and De. acutus are the origin animal of Bungarus Parvus (Jinqian Baihua She, coin-like white-banded snake, JBS), Zaocys and Agkistrodon respectively. They are effective in dispelling the wind, removing obstruction of the collaterals, and relieving spasm, according to the Pharmacopoeia of the People’s Republic of China. In recent years, the medicinal value and ecomomic value of the snakes are improved significantly. And the social demand of snake continues to rise. The supply shortage but huge demand of snake results in its high price in medicine market, and also in the emergence of adulterants. The differentiation of these adulterants merely by their morphological characters is rather difficult because of their high similarities in appearance. Moreover, because of its poor reproductive performance, ecological environment vulnerable to human destruction, coupled with excessive poaching and trafficking, now many species of snake are endangered animal in the list of China Red Data Book of Endangered Animals. The accurate identification of species, can not only ensure the safety and effectiveness of drugs, but also conducive to combat illegal dealers and to control snake resources of trafficking. The accurate identification in traditional methods depends heavily on the inspector’s professional experience. It is necessary to find a convenient and accurate means for distinguishing genuine species of snake from its adulterants.Origin identification, morphological identification, microscopical identification and physico-chemical identification are regarded as the four main identifying methods for snake derived medicinal materials. With the development of modem science and technology, many new identifying methods and modern instruments are applied to the identifications of Chinese medicinal materials of snakes. DNA barcoding is a method of species identification which involves sequencing a standard and specific DNA region. It was first proposed in2003by Hebert and has been demonstrated as a powerful tool for species identification. As a simple and efficient technique, DNA barcode won’t be influenced by the morphological characters and the professional level of researcher. It is particularly suitable for the identification of Chinese herbal medicines which were derived from the tissue or organs of organism.DNA barcoding in Traditional Chinese Materia Medica has developed rapidly in recent years, which accelerates the progress of standardization in identifying Traditional Chinese Materia Medica. COI is a suitable standard DNA barcode gene for animal species has been widely recognized. In recent years, COI also has been proved effective in authenticating medicinal animals such as Cornu Cervi Pantotrichum, Trionycis carapax, Moschus and their adulterants. Therefore, in order to test the feasibility of DNA barcoding in accurate identification of snakes and its phylogenetic analysis, we collected and barcoded the common medicinal snakes in South China.DNA barcoding common medicinal snakes in South China1PurposeTo establish a DNA barcodes database of common medicine snakes from South China area, and analyze the phylogenetic relationship of the species.2Method2.1Samples collectionA total of44specimens from23snake species were obtained. All the species identified by Zhang Liang in South China Institute of Endangered Animals. Vouchers were deposited in School of Traditional Chinese Medicine, Southern Medical University, and all the specimens were preserved in95%ethanol. Tisues were preserved in refrigerator of-20℃2.2PCR primer designationA pair of PCR primers were designed which can amplify the COI sequence from snake species efficiency, with the help of the Primer premier5.2.3DNA extraction and COI amplification1) DNA from the snakes and the crude drug was extracted using TIAN amp Genomic DNA kit following the manufacturer’s instructions, and DNA template quality was detected with1.2%agarose gel electrophoresis.2) COI barcode region was amplified using primers designed by us, primer sequences were:DK1-CO1:5-’CAACTAACCACAAAGACATCGG’-3;DK1-CO2:5-’CTTCTGGGTGGCCGAAAAATCA’-3.PCR amplification was performed in25μl reaction mixtures containing12.5μl2×Taq PCR Colorless Mix,1μl each primer,1μl genomic DNA, and9.5μl ddH2O.The thermal cycling was performed with an initial step at93℃for5min and55℃for2min, followed by35cycles of93℃for30s,55℃for45s, and70℃for45s, with a final extension at70℃for5min and chilling to4℃.2.4PCR product purification and sequencingAfter electrophoresis on1.2%agarose gel, the PCR product was visualized under ultraviolet light, and was purified by Gel Band Purification Kit. Then the PCR products were purified by Gel Band Purification Kit. After purification, the products were sequenced in both directions by Invitrogen Biotechnology (Shanghai) Co., Ltd.2.5DNA sequence alignment and analysisThe DNA sequences combining with the data downloaded in GenBank were manually edited and aligned using the software BioEdit and Clustal X. All the new data were submitted to GenBank and the Barcode of Life Database. The sequence divergences were calculated using the Kimura two-parameter (K2P) distance model, and the genetic distances were computed by MEGA5.0software. A bootstrap (1000replicates) neighbor-joining (NJ) tree was constructed based on the K2P distances, to provide a graphical representation of the divergence patterns among the species. The NJ tree was then confirmed by bootstrapping to assign confidence levels to each branch in the tree.3Results 3.1Sequence analysis of COIWith an aligned length of658nucleotides, the sequences obtained contained no insertions, deletions, or codons. The nucleotide composition and variable sites were analyzed using MEGA5.0. There were277variable sites in the COI barcode sequences of51samples from24species. The nucleotide average content of A、T、 C、G was26.7%、28.1%、29.1%、16.1%respectively. The average (G+C) content of54.8%was higher than the average (A+T) content of45.2%.3.2Analysis of genetic distanceThe intraspecific K2P distance ranged from0-0.049. The maximum intraspecific distance appeared in Z. dhumnades, while the minimum intraspecific distance appeared in Dinodon flavozonatum. The maximum intraspecific distance of B. multicinctus and De. acutus was0.0185and0.0232, respectively.The interspecific genetic distance rang was0.0850-0.2568. The minimum interspecific distance was0.0850between Lycodon synaptor and L. ruhstrati. The maximum interspecific distance was0.2568between N. atra and Elaphe radiate.3.3Neighbor-Joining treeThe snakes examined in this study are clustered in three major clades corresponding to their three families. Each species formed a monophyletic clad with bootstrap supports of100%. The first clade was constituted by31specimens in Colubridae. N. atra, Ophiophagus hannah and B. multicinctus formed the second clade with bootstrap supports of77%. The third clade was constituted by6species in Viperinae with bootstrap supports of98%.4Conclusions4.1Using the primers designed for COI of species of snake, we obtained PCR amplification and sequencing efficiency both of100%.4.2DNA barcoding based on the COI sequences is accurate and reliable and could be applied to identify the common medicinal snakes in our study.4.3The study also provides new reference information for the phylogenetic relationships of snake species. As an efficient classification and identification method, DNA barcoding would play an important role in protection of endangered snake species.Study on the Identification of Jinqian Baihua She (Bungarus Parvus) with DNA barcoding1PurposeTo test the feasibility of DNA barcoding for identification of Jinqian Baihua She and its adulterants.2Method2.1Samples collectionA total of39specimens from9snake species (including B. multicinctus and its adulterants) were obtained.10samples of JBS were purchased from the local drug stores or the crude drug market in Guangdong Province.2.2DNA extraction and COI amplification, PCR product purification and sequencing, DNA sequence alignment and analysis.The steps of these methods identical to the above that "DNA barcoding common medicinal snakes in South China" described.COI barcode region was amplified using primers LCO1490and HCO2198, primer sequences were:LCO1490:5’-GGT CAA CAAATC ATAAAG ATA TTG G-3’,HCO2198:5’-TAAACT TCA GGG TGA CCA AAA AAT CA-3’3Results3.1Sequence analysis of COI The COI barcode regions of39specimens representing9snake species under the name of JBS were sequenced. In total,255variable sites and403conserved sites were found in the COI sequences of B. multicinctus and its adulterants. The GC contents ranged from40.1%to47.4%, with an average value of44.3%; in the specific case of B. multicinctus, the GC content range was42.9%-43.3%.3.2Intraspecific variationAltogether14variation sites were found in15B. multicinctus COI barcode sequences; the transition/transversion value was6. The mean intraspecific K2P distance in B. multicinctus was0.0103, with a maximum of0.0201.The intraspecific K2P distance of Di. rufozonatum, El. plumbea, and X. flavipunctatus ranged from0.0030～0.0361,0.0015～0.0030,0～0.0015, respectively, with the mean values of0.0195,0.0023, and0.0010. The other5species were all0.3.3Interspecific variationThe average interspecific genetic distance was0.2178. The minimum interspecific mean distance could be found between B. multicinctus and B. fasciatus, which was0.1557, far greater than that of0.027recommended by Hebert for species identification. The maximum interspecific mean distance,0.2578, was found between B. fasciatus and De. acutus.3.4Neighbor-Joining treeIn the NJ tree each species formed a monophyletic clade with bootstrap supports of100%. B. multicinctus could be differentiated clearly from the adulterants. It first clustered with B. fasciatus, a species of the same genus, and then with N. naja. These3species formed a branch representing Family Elapidae. The clades of Family Colubridae genera paralleled to Elapidae branch, and combined with it to form a cluster joining Deinagkistrodon, Family Viperidae. Inside the clade of B. multicinctus,2subclades could be obviously recognized. 3.5JBS crude drug identification by BOLDAll of the10purchased crude drug samples of JBS were clearly identified at the species level with the BOLD identification engine. Each sample gave a maximum identity of99.08%-100%in COI sequence to the matched species. The results were consistent with opinions of the invited expert who examined the samples on a morphological basis.4Conclusions4.1It is concluded that Bungarus parvus and its adulterants can be correctly identified by using COI barcode sequence. DNA barcoding is a new tool that could make up the weak point of traditional morphological methods, and be widely used in the practice.4.2We uploaded all the COI sequences to BOLD under the project title "DNA barcoding Bungarus multicinctus and its adulterants". All JBS samples could be clearly identified at the species level using the identification engine provided by the BOLD system.