Font Size: a A A

Study On The Resistance Molecular Detection And Field Monitoring Techniques Of Tetranychus Urticae To Fenpropathrin

Posted on:2015-05-09Degree:MasterType:Thesis
Country:ChinaCandidate:X L YueFull Text:PDF
GTID:2283330452460677Subject:Pesticides
Abstract/Summary:PDF Full Text Request
The control of Tetranychus urticae, a worldwide agricultural pest, has beenlargely dependent on pesticides. Fenpropathrin is one of the pyrethroid pesticides witha broad spectrum insecticide with quick knockdown effect, long duration and goodcontrol effect on many kinds of pest insects and spider mites. However, due to a largenumber of irrational pesticides using, the mites’ population has caused seriousresistance and cross-resistance to pyrethroid insecticides. Resistances to fenpropathrinin T. urticae are primarily conferred by reduced sensitivities of target sites,which aredue to point mutations,such as L1024V and F1538I in the voltage-gated sodiumchannel gene. In this study, in order to monitor the field resistant populations, a kindof molecular-based monitoring system which was mainly used direct sequencing ofPCR products and PCR-RFLP was preliminarily established based on the detection ofthe resistant mutations in fenpropathrin-resistant strains of T. urticae. Thedetoxification enzyme activity and mRNA expression levels of14detoxificationenzyme genes were examined and analyzed, which are aimed to verify themolecular-based resistant monitoring system for monitoring field populations atphysiological and biochemical levels. The main results obtained are as follows:1. Detection of gene mutations and establishment of monitoring technologyin laboratory fenpropathrin-resistant strain of T. urticae.Through direct sequencing of PCR products combined with the polymerase chainreaction-restriction fragment length polymorphism (PCR-RFLP), we initiallyestablished a molecular-based monitoring system for monitoring different fieldresistant populations of T. urtica. The results showed that2mutations, A1215D andF1538I, were found in laboratory fenpropathrin-resistant strain (Fe-R) of T. urticaeby using2specific primers B1(ATCGGTCAACTTCGCTCAAC) and B2(GTTTACATCAGCAGTCAC), C1(TTCAAGTGGCAACATTCAAAGG) and C2(GTAATGGTCAAGGGACATCACA).2. Monitoring of different field resistant populations of T. urticae.According to the established molecular-based monitoring system, the resistance of collected5different field populations (Lanzhou population LZ-R, Gannanpopulation GN-R, Wuwei population WW-R, Tianshui population TS-R and Linxiapopulation LX-R) of T. urtica to pyrethroid insecticides was initially monitored. Theresults showed that no L1024V mutation was detected in all field populations of T.urtica when comparied with SS. Two mutations, A1215D and F1538I were detectedin LZ-R, WW-R and TS-R, only F1538I mutation was detected in GN-R. On thecontrary, A1215D and F1538I mutations were not existed in LX-R. This indicated thatLZ-R, GN-R, WW-R and TS-R populations were conferred moderate-or high-levelresistance to fenpropathrin.3. Analysis of the expression levels of detoxification enzyme genes indifferent field populations of T. urticae.The mRNA expression levels of14detoxification enzyme genes were examinedin5different populations of T. urtica by using qRT-PCR. The qRT-PCR analysisshowed that the expression levels of different detoxification enzyme genes weredistinct in all populations of T. urtica. Among the14genes, over-expression ordown-expression of GSTs gene TuGSTd01, TuGSTd04, TuGSTd05, TuGSTd06andTuGSTd09, P450s gene CYP406A1, CYP4CL1and CYP387A1, CarEs geneTuCCE-35were at least in part, associated with the resistance to fenpropathrin in T.urtica.4. The resistance ratio and synergism of3synergists on fenpropathrin indifferent field populations of T. urticae.The resistance ratio to fenpropathrin in5field populations of T. urticae weremeasured by using slide-dip method, the results were GN-R (60.53)> WW-R (27.38)>LZ-R (23.06)> TS-R (22.95)> LX-R (22.50). The results showed that GN-Rpopulation reached a high-level resistance (40<RR <160) while LZ-R, WW-R,TS-R and LX-R also reached moderate-level resistance (10<RR <40). In all fieldpopulations, the resistance ratio was the lowest (22.50times) and with no F1538Imutation in LX-R, which was consistent with the results of using field resistancemonitoring methods as there existed resistance-associated F1538I mutation in other4populations of T. urticae. Synergist test showed that the synergistic ratio of PBO to fenpropathrin was higher in all filed populations, especially in WW-R andZY-R populations (synergistic ratio were5.15and6.66folds, respectively), thisindicated that fenpropathrin resistance may be mainly produced with the enhancedcapacity of oxidative metabolism of MFOs. Similarly, the synergistic effect of TPP inGN-R and WW-R, DEM in WW-R were all significant (2.39,2.94and8.32folds,respectively). Therefore, to some extent, the generation of resistance to fenpropathrinhad a certain relationship with the enhanced ability to detoxify in CarEs and GSTs ofT. urticae.5. Analysis of the main detoxification enzyme activity in different fieldpopulations of T. urticae.The specific activity of CarEs in all field populations of T. urtica weresignificantly increased1.33-1.56folds than that in SS population, indicating that theremay be a great relationship between the generation of resistance against fenpropathrinand the enhanced detoxification enzyme activity of CarEs in T. urtica. Similarly, thespecific activity of GSTs in TS-R, LX-R and MFOs in TS-R were also increased, tosome extent, GSTs and MFOs may be also involved in the resistance to fenpropathrin.As a result, our study verified that differences in gene expression levels of detoxifyingenzymes in GSTs, MFOs and CarEs families may be linked to the resistance tofenpropathrin in T. urtica.In summary, the established molecular-based monitoring system of the resistancein T. urtica to fenpropathrin can be used to monitor the field resistant populations withcertain field application feasibility.
Keywords/Search Tags:Tetranychus urticae, fenpropathrin, target mutations, moleculardetection, gene expression levels, pesticide resistance, field monitoring
PDF Full Text Request
Related items