Development Of Human Monoclonal Antibodiy Against Hepatitis B Surface Antigen

Hepatitis B virus (HBV) Infection is one of the commonest infections in the world.2 billion people were ever infected with the virus, and about 350 millions of people are in chronic infected state. More than 1 millon people with liver failure, cirrhosis, and hepatocellular carcinoma (HCC) associated with HBV infection are estimated to die every year. In China, there are approximately 93 million chronic HBV carriers, and 20 million patients suffering from chronic hepatitis B. Hepatitis B vaccine (HepB) was formally included in "Immunization Programme" for infants by Ministry of Health in 1992, since then, the universal infants HepB immunization programme has been implemented in China, and the infection rate decreased gradually. However,30% to 50% of chronic hepatitis B patients were caused by vertical transmission in our country. Newborns from HBsAg positive mothers should receive hepatitis B immunoglobulin (HBIG) and hepatitis B vaccine less than 24 hours after delivery and complete the whole recommended vaccination injections. Liver transplantation is an effective method for end-stage liver disease management. 90% of people received liver transplantation had liver diseases related to HBV. Liver transplantation can not eliminate HBV of organs outside of liver and in the blood. Because of the inhibit of immunity, HBV re-inefetion occur frequently, aggravateing faster than before liver transplantation, which can cause acute liver failure,fibrous cholestasis hepatitis and liver cirrhosis, and 50% of patients died in two years. Combination therpy with HBIG and lamivudine was shown to be an effective way. Medical staff who contact the blood or blood fluids of HB V carriers should receive HBIG immediately if their anti-HBs titers are below 10 mIU/mL.HBIG is antibodies prepared from the blood plasm of hepatitis B surface antigen-specific-antibody (anti-HBs) positive person through natural infection or vaccination. Being human plasma-derived product, HBIG is inconvenient for large acquisition, and also there are risks associated with the blood borne infectious pathagents such as Hepatitis C virus (HCV), human immunodeficiency virus (HIV). Besides, HBIG is poor in homogeneity. Our aim is to prepare monoclonal anti-HBs using an improved method of Epstein Barr virus(EBV) immortalization and by construction of libraries of full-length antibodies.PartⅠEBV immortalizationMethod(1) Prepare virus stock from an EBV-transformed B95-8 marmoset cell line. (2) Synthetic CpGDNA(motif:TCGTCGTTTTGTCGTTTTGTCGTT). (3) Preparation of peripheral blood mononuclear cells (PBMC):We chose three young healthy volunteers, which had accomplished program Hepatitis B vaccination and got positive results. We collected the blood sample at the 7th day after booster vaccination. For each selected volunteers,30ml of peripheral blood were collected in Vacutainer tube containing heparin. PBMC were seperated by Ficoll density gradient centrifugation. PBMC were counted, and then suspended at a density of 1×106/ml in 10ml RPMI 1640 medium, supplemented with 20% fetal bovine. (4) Immortalization of lymphocytes:Initiation of immortalization was achieved by mixing the cells (1×106/ml) in 1ml RPMI 1640 complete medium, 1ml of active EBV supernatant and 2 ug/ml CyA in 24 well plate. After 18～24 hours, all of the supernatant was replaced by fresh medium containing 2 ug/ml CyA and 2.5 ug/ml CpG.A week later,half of the supernatant was replaced by fresh medium containing 1 ug/ml CyA and 2.5 ug/ml CpG. The anti-HBs titer of the supernatant were determined by the Architect anti-HBs assay (Abbott Architect i2000). After that, refresh half of the supernatant every 2-5days. (5) Preparation of feeder cells. Some of the immortalized B cells were radiated byγ-ray at 10 Gy for lminunts. (6) Limited dilution. Anti-HBs positive cells were cultured at 1,2, or 10 cells per well in 96 well plate, added with 5×104 feeder cells. Repeat the procedure 2 times to make sure that the monoclonal cell is anti-HBs positive. (7) Immunocytochemical (ICC) staining (SP) method was used to identify the differentiation of the cell clones. Buffer was used as negative control,and tonsil/HBV infection liver tissue was used as positive control. CD20 and CD138 were determined according to the standard procedure, and diluted recombinant HepB was used to mediate the dectection of anti-HBs.ResultsImmortalized B-cell culture from the cell clones secreting anti-HBs was successfully established. After 3-5days proliferation, these cells were about twise as big as normal B cell. The cells are suspended or slightly adherent, growing to forming colonies. The cells scattered among the colonies gradually decreased. After 3-4 weeks, the colonies significantly enlarged. The cells propagated for at least 3 months in vitro. Anti-HBs titer in the culture supernatant of the immortalized B-cells kept at a high level for 2 weeks after PBMC immortalization,and then depressed gradually. After 2 months of culture, ICC staining showed CD138 positive on cell membrane and cytoplasm in most cells, and anti-HBs positive on both cell membrane and cytoplasm in small proportion.ConclusionImmortalized B-cell culture secreting anti-HBs were successfully established; Monoclonal Immortalized B-cells could be seperated; CpG increased the efficiency of B cell immortalization. Anti-HBs titer in the culture supernatant of the immortalized B-cells kept at a high level for 2 weeks after immortalization, the ability of secretion of anti-HBs in cell culture was gradually decreased.PartⅡConstruction of a mammalian cell-based full-length fully human anti-HBs antibody display libraryMethodHuman peripheral blood mononuclear cells (PBMC) were isolated from a healthy volunteer 7 days after the procedural immune. The total RNA was extracted from PBMC by RNA easy-kit. The amplification of human antibody variable domain of heavy-chain (VH) and full length kappa chain (LCκ) was carried out using PCR using specific forward and reverse primers. The vector pDGB-HC-TM and PCR amplified DNA fragments were digested by proper restriction enzymes, BsmB I for VH, and Sfi I for LCκ. The target fragments were purified by agarose gel electrophoresis and DNA fragments were mixed in equal molor for ligation. Amplified VH and LCκproducts were inserted into the vector separately. Heavy chain libraries were digested by BsmB I and light chain libraries were digested by BstX I. The vector pDGB4-FCS were digested by BsmB I and BstX I, then the four DNA fragments were ligated. The ligation was performed at 16℃overnight, then the ligated vector was transformed into competent E.coli TOPO-10 cells. Amicillin resistant colones were calculated.10 clones from HC library and 10 from LC library have been randomly picked up for sequence analysis of VH and LC regions. The transfection of FCHO cells was carried out in 6-well plate. The antibody expression on cell surface was detected by FACS and the data were analyzed using FCS Express V3 software. Monoclonal cells were sorted by fluorescence activated cell sorting (FACS). Isolated monoclonal cells were analyzed for the expression specific antibodies on cell surface. ELISA were also used to analyzed the expression of the anti-HBs antibodies in culture media.ResultsMammalian cell-based full-length fully human anti-HBs antibody display libraries were successfully Constructed. We have constructed a HC (IgG-1) library and LCκlibrary with library sizes of 1.7×105 and 1.2×105 respectively. Sequence analysis of VH and LC regions of 10 clones from HC library and 10 from LC library showed that ten HC clones have correct reading frame, coding for ten unique VH and nine LC clones have correct reading frame, coding for eight unique LCk. The combinatory diversity of the libraries is 1.836×1010. Plasmid DNA from each clone was co-transfected with expressibility-confirmed HC or LC clones into FCHO cells. The expression of full-length antibody on cell surface was confirmed by FACS for ten HC clones and eight LC clones. After co-transfection of the HC library and the LC library into FCHO cells, the antibody expression was analyzed by FACS. Cells were stained by PE-K. Results showed that 66.53% of the cells have detectable antibody expression on cell surface. With the VH and LC inserted into the vector pDGB4-FCS, We had constructed a four-way library with library sizes of 7.27×104. The stable FCHO cell population of the four-way library was established and co-stained with HBsAg and anti-kappa chain antibody. Cells secreting anti-HBs antibodies were sorted, expanded and re-analyzed, showing five fold enrichment after a single sorting. Seven out of the twenty-six monoclonal cells populations displayed anti-HBs antibodies in FACS analysis and three of them were anti-HBs positive in ELISA analysis. ConclusionWe have constructed an full-length anti-HBs antibody display library with a combinatory diversity of 1.428×1010. Monoclonal cells secreting anti-HBs antibodies were isolated successfully.