The Effect And Mechanism Research Of Rho/ROCK Signal Transduction Pathway On Hypoxia Induced Apoptosis Of Neuron

ObjectiveTo study the expression and function in ROCK1, ROCK2of Rho/ROCK signaling pathway on hypoxia induced apoptosis of neuron. To explore the role and the molecular mechanism of Rho/ROCK signaling pathway on neuronal apoptosis of hypoxia.Materials and Methods1.The rat spinal cord neural stem cells were cultured and differentiation, and were identified with cell morphological,the NeuN immunohistochemical and immunofluo-rescence.2.Searching the rat ROCK1and ROCK2gene sequences in GeneBank, constructing the shROCKl and shROCK2carriers, screening the higher inhibition efficiency shROCK1and shROCK2plasmid, then transfecting spinal cord neurons.3.Establishment of cell model, the groups were as follows:1Blank;2Hypoxia;3Hypoxia+Negative;4Hypoxia+shROCK1;5Hypoxia+shROCK2.The experimental groups were used to detect the apoptosis and related gene expression level.4.Flow cytometry technology of Annexin-FITC/PI double staining method was applied to detect spinal cord neurons’apoptosis.5.Immunofluorescence technology was applied to detect neural cell apoptosis related factors (Caspase-3, HIF-la) influence and the expression of ROCK1, ROCK2on Rho/ROCK signal pathway.6.Total RNA was extracted from the cells, corresponding expression changes of ROCK1,ROCK2, Caspase-3and HIF-1α genes was detected by Real-time qPCR.7.Total protein was extracted from the cells, corresponding expression changes of caspase-3and HIF-1α protein was detected by Western blot.Resultsl.Rat spinal cord neural stem cells tended to be a large number of mulberries shape suspended nerve after in vitro, and slowly to differentiate into adherent growth of nerve cells. Immunofluorescence showed that the Nestin and SOX2protein expre-ssion was positive and the cells with stem cell properties. Immunohistochemical stain-ing confirm that the cultured cells were neural cells because it showed that cultured spinal cord nuclei were obviously coloration and PBS were obvious difference.2.The results of shROCKs carrier build: shROCK1-1:5’-AGCTT AAGCTGGATAAGTCTGGACATTCTCTTGAAATGTCCAGACTTATCCAGC G-3’ shROCK1-2:5’-AGCTT AACAGAGATGAGCAAGTCAGTTCTCTTGAAACTGACTTGCTCATCTCTG G-3’ shROCK2-1:5’-AGCTT AAGAGGTACGACTTGGAAGAATCTCTTGAATTCTTCCAAGTCGTACCTC G-3’ shROCK2-2:5’-AGCTT AAGTGACATAGACAGCAGCAATCTCTTGAATTGCTGCTGTCTATGTCAC G-3’ They were proven to be correct sequence after using Chromas and BLAST tools comparison of sequencing results. The relative expression level of Real-time qPCR detection of ROCK1and ROCK2genes:shROCKl-1=0.97, shROCKl-2=0.66, shROCK2-1=0.52, shROCK2-2=0.38. The relative expression level of Western blot of ROCK1,ROCK2protein: shROCKl-1=0.38, shROCKl-2=0.19, shROCK2-1=0.37, shROCK2-2=0.23.We selected shROCK1-2and shROCK2-2as the carrier interfere-ence in this experiment.3.The apoptosis rate of the5groups neurons respectively were0.73%,1.63%,0.81%,1.31%,0.66%at0h.The apoptosis rate of the5groups neurons were1.32%,22.62%,19.92%,14.51%,8.40%at24h post-hypoxia respectively. The apoptosis rate of the5groups neurons were0.96%,31.29%,30.13%,19.40%,17.14%at48h post-hypoxia respectively.The apoptosis rate of the5groups neurons were2.10%,48.27%, 41.97%,6.59%,5.58%at72h post-hypoxia respectively.4.The expression of ROCK1and ROCK2were localized in the cytoplasm and the ROCK2basal expression level was weaker than ROCK1.The ROCK1and ROCK2expression were enhanced when the spinal cord cells were induced by hypoxia. But the ROCK1and ROCK2expression were decreased and similar to the blank group when two genes were suppressed. The expression of Caspase-3and HIF-1α were also localized in the cytoplasm. Their basal expression are relatively weak. The Caspase-3and HIF-1α expression were enhanced when the spinal cord cells were induced by hypoxia. But the Caspase-3and HIF-1α expression were decreased and similar to the blank group when two genes were suppressed.5.The ROCK1,ROCK2,Caspase-3and HIF-1α gene expression were enhanced when the spinal cord cells were induced by hypoxia. The Caspase-3expression was enhanced that demonstrated that apoptosis of neuron. But the ROCK1,ROCK2, Caspase-3and HIF-1α gene expression were decreased when two genes were suppressed.6.The Caspase-3and HIF-1α protein expression were enhanced when the spinal cord cells were induced by hypoxia. But the Caspase-3and HIF-1α protein expression were decreased and compared with the hypoxia group the difference was significant (P<0.05) when ROCK1,ROCK2protein expression were suppressed.ConclusionsRho/ROCK signal transduction pathway took an important part in the process of neuron apoptosis induced by hypoxia. Moreover, they might induce neuron apoptosis by the Caspase-3pathway and HIF-1α gene way. The ROCK1,ROCK2specific siRNA significantily inhibited the ROCK1,ROCK2,Caspase-3and HIF-1α gene transcription level and protein expression and inhibited the spinal cord neurons apoptosis.