| Nasopharyngeal Carcinoma(NPC) is a highly malignant tumor derived from nasopharyngeal epithelium. As the tumor progression, other important structures of the skull base are vulnerable to the violations of it, and early cervical lymph node metastasis and distant metastasis occur. It has been manifested as ethnic and regional distribution by epidemiology. Characterized by a high incidence of malignant tumors, one of China’s top ten, its incidence rate 20/100,000, has caused serious health problems. NPC is a complex disease caused by Epstein Barr virus(EBV) latent infection, and environmental factors and genetic factors, in a multi-step process of carcinogenesis. All nasopharyngeal carcinoma cells have the appearance of EBV genomes and express EBNA1, EBER1, 2, and LMP1, LMP2 A, LMP2 B, which makes these viral proteins as an ideal tumor marker, in which LMP2(latent membrane protein2, LMP2) plays an important part in nasopharyngeal epithelial cells transformation and oncogenesis and is now recognized as one of the virus cancer gene. It involved in the occurrence of nasopharyngeal carcinoma and development of the entire process. With LMP2 A as the target goal, an antibody targeted to the goal was prepared and it will provide a new targeted therapy and diagnosis for nasopharyngeal carcinomaThis study intended to use genetic engineering technology designing and expression of LMP2 A epitope fusion protein-LMP25 and analysis its immunogenicity. Using purified LMP25 protien and nasopharyngeal carcinoma cells(SUNE, CNE) through screening phage antibody display technology biopanning anti-LMP2 A extracellular region antibody Fab(Fab29). Expression and purification of Fab29, further we analyzed characteristics of this antibody: the in vitro experiments showed that Fab29 can specific bind SUNE(LMP2A-positive) extracellular region.Methods1. Design and construction of expression vector of the fusion epitope: according to the reports of LMP2 A gene sequences in the Genebank, we selected LMP2 A epitope gene sequences. LMP2 A second extracellular region genes as: TGTCTGACGTGGCGTATTGAAGACCCGCCGTTTAACAGCCTGCTGTTT GCCCTGCTGGCAGCAGCCGGT and LMP2 A extracellular region gene of 5: GGCGGCAGCATTCTGCAAACCAACTTCAAAAGCCTGAGCAGCACCGA ATTCATCCCGAACCTGTTT. To construct LMP2 A a fusion protein expression carrier, we optimized the design of the fusion protein gene sequences of both second and five extracellular region of LMP2 A. In the 5 ’and 3’ set enzyme cutting site Bam HI and Xho I respectively and clone in p ET28 a expression vector.2. Expression and purification of the fusion epitope protein LMP2A: after sequence confirmed, the recombinant expression vector was transferred into e. coli BL21. We selected monoclonal colony, expanded the monoclonal colony and the induced LMP25 expression. The expresstion product was denaturated by 8M urea and purified by Ni- NTA column chromatography techonology and renaturated. After that Coomassie brilliant blue staining was used to detect the purity of LMP25 protein.3. Identification of the recombinant fusion protein: the purified recombinant fusion protein LMP25 was analyzed by Western blot. Then using purified LMP2 A recombinant epitope fusion protein immunization of immune mice, the antiserum titer, the specificity of the polyclonal antibody and immunogenicity of LMP25 were detected by ELISA and immunohistochemisty.4. Biopanning: both of nasopharyngeal carcinoma cells(SUNE, CNE) and purified antigen LMP25 were used to biopanning phage antibody library(Fab antibody libraries) by combination of solid phase selection and subtractive selection(1, 3, 5 subtractive selection; 2, 4, 6 solid phase selection). CNE cell was LMP2A-negative cells and SUNE cell was LMP2A-positive cell in the process of subtractive selection; purified LMP2 A fusion protein was used the process of solid phase selection. After 6 rounds of biopanning, the positive clone phages were identified by ELISA.5. Identification and purification of prokaryotic expression antibody-Fab29: firstly, e. coli Top 10 F’ was infected by Fab29 phage, then the infected e. coli Top10F’ cultivated into logarithmic growth phase. After that it been induced by IPTG. Expressed Protein products was purified by Protein L column.6. Analysis of biological characteristics of purified Fab29: Specificity, the rate of combination and affinity were analyzed by ELISA and flow cytometry technology, immune co-precipitation, immunofluorescence, affinity test and immunohistochemistry.Results1. Confirmed by nucleic acid sequence analysis LMP2A’s second and five extracellular region repeat series gene were consistent with the purpose of the design and then it had been cloned in p ET28 a expression vector.2. SDS-PAGE result showed that plasmid expressed in e. coli successfully and its yield was very high. By His-affinity chromatography purification of denaturation LMP25 and afterwards we renaturated it and analyzed it by SDS-PAGE. The result of SDS-PAGE showed that the degree of purity was of high3. By Western blot test the purified protein revealed that it can be captured by rats anti-LMP2 A antibody. Then we used this protein to immune mice to produce polyclonal antibodys. Afterwards the antibody analyzed by ELISA. The result showed that When the concentration of antibody decline to 25, 6000, its OD450 value is less than 0.2. Compared with rats anti-LMP2 A antibody, polyclonal antibodys showed the same characteristic with rats anti-LMP2 A antibody. They both could identify LMP2 A in tumor biopsies of nasopharyngeal carcinoma patients.4. Gene sequence test showed that selected no.29 antibody Fab light chain is kappa chain and heavy chain is lambda chain.5. Fab29 could express in prokaryotic expression system correctly. Using affinity chromatography of Protein L we gained the high-purity soluble antibody-Fab29.6. ELISA result showed that when the concentration of Fab29 reach to 50μg/ml, the value of OD450 can reach 1.613; flow cytometry technology revealed that the binding rate of Fab29 and SUNE cell reached as high as 96.89%; immune co-precipitation showed that the protein been captured by Fab29 was LMP2A; immunofluorescence result illustrated that the binding position of Fab29 was on the surface of the SUNE cel L; antibody affinity test result showed the affinity between LMP25 and Fab29 is 1.79 x 10-9; immunohistochemical result showed Fab29 could combine with LMP2A-positive tumor cells of nasopharyngeal carcinoma patients.Conclusions1. This experiment proved that LMP2 A extracellular region LMP25 repeat series carrier can be expressed in prokaryotic expression system which designed by the genetic engineering. Purified soluble LMP25 protein can be used to immune mouse and acquired high affinity polyclonal antibodies. Immunohistochemical results demonstrate that LMP25 has high stability and immunogenicity. It can represent LMP2 A protein and be used in biopanningof LMP2 A antibody.2. Through all anthropogenic antibody library, using subtractive selection method and solid phase selection method can obtain high affinity antibodies Fab29 anti-LMP2 A extracellular area.3. Soluble Fab29 can be expressed in prokaryotic expression system. ELISA, FACS, IP, IF, Affinity Test and IHC showed that Fab29 has high affinity with natural LMP2 A protein.In short, this study designed LMP25 which can represent the biological characteristics of the EBV encoded-LMP2 A protein. using the purified recombinant protein LMP25 and nasopharyngeal carcinoma cells we screened a human antibody-Fab29 which against LMP2 A. Through a series of biological evaluation test showed that the monoclonal antibody specificity combined with natural LMP2 A protein. This antibody can be used as a tool to study of LMP2 A protein. It has more significance in the study of tumor. Fab29 can be used as a carrier for tumor imaging diagnosis and immunotherapy. |
PDF Full Text Request