| BackgroundLiver fibrosis is a continuing process of pathological changes caused by various pathogenic factors, which can lead to abnormal increase of connective tissue synthesis and secretion, and liver extracellular matrix (ECM) excessively deposition. It is also an important intermediate links that can develop to cirrhosis and liver cancer. It is reported that the incidence of cirrhosis is about 1% of the total number of hospitalized patients which accounts for the sixth place of all-cause death.This will have a significant impact on the whole society. Basic and clinical studies have demonstrated that liver fibrosis is a reversible process. Despite early diagnosis and timely intervention of liver inflammation reaction caused by the primary disease can prevent the development of liver fibrosis in a certain extent, there is no affirmative and effective antifibrotic drugs. Therefore, in order to better study the mechanism of liver fibrosis, discover antifibrotic drugs and verify its efficacy, it is important to establish a stable and reliable liver fibrosis animal model.The traditional animals of hepatic fibrosis model generally are mice, rats or rabbits. The established models include toxic liver injury model, cholestatic liver injury model, immunological liver injury model and transgenic animal model. Compared with traditional animals, zebrafish have some advantages such as low cost, convenience of feeding and management, short reproductive cycle, large numbers of progeny, simple molecular genetic manipulation etc, which can compensate for some shortcomings of traditional animals such as high cost, relatively less samples and complex modeling operations. Based on zebrafish’s own characteristics, it is more feasible to establish liver fibrosis model by toxic drugs-induced and genetically modified methods. Compared to genetically modified method, drug-induced method have advantages of little technical difficulty and experimental short cycle. Diethylnitrosamine (DEN) is a cancer-causing cytotoxic agent with a clear affinity for the liver. After transformed in particles, DEN can cause nucleic acid and protein methylated, liver cells necrosis, and then stimulate ECM synthesis and secretion so as to promote the formation of fibrosis. Furthermore, DEN is water-soluble with a stable physical and chemical propertie at room temperature, so it meets the conditions of zebrafish model establishment and can be administered by direct immersion. Thus, we use DEN to induce liver damage. Since liver fibrosis often appear before the formation of liver tumors, we collect specimens at different time points to assess liver histopathology changes during experiment.Excessive deposition of ECM is the basis of liver fibrosis formation. When the liver is damaged by the exogenous stimuli, hepatic stellate cells are the main cells of ECM synthesis and secretion. Since there are less cells at zebrafish liver tissue and zebrafish HSCs primary isolation exists technical difficulty, therefore wild-type zebrafish liver fibrosis pathogenesis at cell level is not easy to achieve. The preliminary studies of our team found that purine signaling pathway and endoplasmic reticulum stress had a close relationship with zebrafish liver diseases. And it is reported that these pathways involve in the regulation of liver fibrosis progression. Therefore, this study is designed to detect the related genes expression level of purine signaling pathway and endoplasmic reticulum stress by using Real-time RT-PCR method, which explore the pathogenesis of liver fibrosis in zebrafish.CRISPR-Cas9 system is a gene modification technology that Cas9 protein is guided by RNA, which can induce DNA damage and DNA double-strand breaks (DSBs) at DNA target sites. DSBs can activate intracellular Non-homologous end-ing-joining (NHEJ) or homologous recombination (HR) so as to realize the genome fixed-point editor. At present, this technology has been successfully applied to genetic transformation of organisms such as human cells, bacteria, plants and zebrafish. According to the preliminary results of the zebrafish liver fibrosis pathogenesis, we use CRISPR-Cas9 system to modify key genes that participate in formation of zebrafish liver fibrosis, try to build key genes knockout zebrafish mutants for further observing key genes functions on zebrafish liver fibrosis. This may supply stable and reliable model organisms for antifibrotic drugs screening.AimTry to establish zebrafish liver fibrosis model by DEN-induced toxic liver injury method and to assess the feasibility and stability of this model. Discuss the preliminary pathogenesis of zebrafish liver fibrosis from the purine signal pathway and endoplasmic reticulum stress. And use CRISPR-Cas9 system to modify key genes so as to investigate the effects of key genes deletion on zebrafish liver fibrosis. This will lay a foundation for further exploring the pathogenesis of liver fibrosis and developing effective antifibrotic drugs.Materials and Methods1、Animals3-month-old wild-type AB strain zebrafish (Danio rerio) were provided by Laboratory of Guangdong Province zebrafish model of human disease and drug screening in Southern Medical University kindly. According to Westerfield standard procedures, zebrafish were maintained 14 hours light and 10 dark cycles at 28.5℃.2、Diethylnitrosamine(DEN) treatmentZebrafish were randomly divided into treatment group and control group (60/group), and housed in different aquariums. DEN was put in aquarium directly, the liquid was replaced every two weeks. At different time points such as the second week, the fourth week and the sixth week, zebrafish (20/group) were randomly selected from each group to detect relevant indicators of liver fibrosis.3、Detection of zebrafish height, weight, body mass index (BMI) and liver indexZebrafish’s height (cm) and weight (g) were measured at different time points respectively, liver tissue was rapidly dissected under a microscope, and wet liver tissue was weighed (g), BMI and liver index were calculated.4、Histologic AnalysisZebrafish were fixed with 4% paraformaldehyde for five days, embedded in paraffin according to standard procedures.4μm sections were stained with hematoxylin and eosin (HE), Gomori staining and Sirius red staining at different time points, and imaged on an Olympus BX51 microscope.5、Detection of genes expression levels by Real time RT-PCR method Liver total RNA was extract by Trizol, and RNA concentration and purity were detected by UV spectrophotometry (Nanodrop, Thermo Fisher Scientific, USA). Reverse transcription was used PrimeScriptTM RT reagent Kit with gDNA Eraser (TAKARA). Real time RT-PCR were carried out on LightCycler(?)Nano.6-. Establishment of zebra fish mutants by CRISPR-Cas9 systemDesign sgRNA according to the genome, use pXT7-hcas9 plasmid as a template to transcript Cas9 mRNA in vitro. Premix Cas9 mRNA with gRNA by a certain percentage(300ng/ul～500ng/ul:100ng/ul～300ng/ul). Single-cell fertilized eggs were collected for microinjection, and Cas9 mutation efficiency was detected by restriction endonuclease after injection 24 hours, and FO embryos that had a higher mutant and survival rate were raised until sexual maturity. Then adult FO zebrafish crossed with WT ones, collected the embryos which were regarded as F1, confirmed the germline transmission by measuring F1 mutantion. Raised F1 until sexual maturity and then measured their mutantion type.7、Statistical analysesStatistical analyses were carried out by using SPSS 13.0 statistical software. The results were expressed as mean±SD. Considering that both DEN and DEN treatment time might have an impact on genes expression, we used two-way ANOVA for analysis, all groups were using LSD multiple comparison method (least-significant difference test). If heterogeneity of variance, using the Dunnett’s T3 law. Two groups were compared using two independent samples t test. Differences were considered significantly at P<0.05 level. Sigmaplotl0.0 software was used to draw figures.Results1、General condition of zebrafishCompared with the control group, DEN-treated zebrafish had some unnormal conditions such as decreased appetite and less movement at the first week during the experiment. And appetite gradually increased from the second week, this situation was considered that zebrafish had tolerated with DEN. During the experiment, no zebrafish of DEN-treated group and control group showed ulceration of scales and gill, or other morphological abnormalities.2、The growth and development of zebrafishThe results showed that zebrafish height and liver index had no difference between DEN-treated group and control group at different time points. And there were no difference in weight and BMI between two groups at the second week and fourth week, while the weight and BMI index of zebrafish in DEN-treated group decreased comparing with control group at the sixth week, which had a significant difference(P<0.05). This prompted that with the extension of treatment time, DEN could inhibit zebrafish growth.3、Histopathological changeDuring the experiment, zebrafish liver tissue had a structural integrity and liver cells were arranged in neat rows. No hepatitis pathological changes and fibrous tissue were found in control group. At the second week, zebrafish liver tissue showed mild inflammation, but no fibrous tissue was found. At the fourth week, there were degeneration and necrosis of liver cells, the synthesis and secretion of reticular fibers increased, but no collagen fibers were found. At the sixth week, the liver tissue was disordered, the synthesis and secretion of reticular fibers and collagen fibers increased so much that fibrous nodule had formed. This indicated that the synthesis and secretion of reticular fibers happened earlier in liver fibrosis, and with the disease’s development, collagen fibers gradually increased too.4、The incidence of zebrafish liver inflammation and fibrosisThe incidence of zebrafish liver inflammation was 60%(at the second week), 80%(at the fourth week) and 100%(at the sixth week), the incidence of liver fibrosis increased from 30%(at the fourth week) to 80%(at the sixth week), which indicated DEN could cause zebrafish liver damage in a time-dependent manner.5、The expression of zebrafish liver fibrosis related indicatorsThe genes expression levels were analyzed by Real-time RT-PCR method at different time points. The results showed that expression levels of Acta2, Collal, TGF-β, MMP9 and TIMP1 mRNA in DEN-treated group were higher than those in control group respectively with statistical significance (P<0.05), which further comfirmed zebrafish liver fibrosis model induced by DEN was stable and reliable.6、Preliminary study results of zebrafish liver fibrosis pathogenesisThe genes expression levels of adenosine pathway, endoplasmic reticulum stress, apoptosis and autophagy pathway were analyzed by Real-time RT-PCR method at different time points. It was shown that CD73 involved in zebrafish liver fibrosis formation. However, the expression levers of adenosine receptors Al, A2aa, A2ab and A2b were no significant difference between DEN-treated group and control group during the experiment. This indicated adenosine pathway mediated by CD73 did not participate in the zebrafish liver fibrosis formation.Besides, ER stress was also found to participate in liver fibrosis formation. It turned out that comparing with control group, ER stress related genes such as BiP/GRP78, PERK, ATF6, IRE1 and CHOP had a higher mRNA expression level in DEN-treated group(P<0.05). Further detecting the expression of apoptosis and autophagy pathway genes mediated by ER stress showed that apoptosis factors such as Caspase-3, Caspase-8 and Caspase-9 had no significant difference between two groups, and the expression of anti-apoptotic factor Bcl2 had a higher mRNA expression level in DEN-treated group(P<0.05). This indicated the apoptosis pathway might have no impact on zebrafish liver fibrosis formation. What is more, we found that autophagy related genes such as Atg3, Atg12 and Beclinl had a higher mRNA expression level in DEN-treated group (P<0.05), which indicated that autophagy might play a role on zebrafish liver fibrosis formation.7、Establishment of CD73 and BiP/GRP78 zebrafish mutants by CRISPR/Cas9 systemBased on the preliminary study on pathogenesis of zebrafish liver fibrosis, we used CRISPR/Cas9 system to modify CD73 and BiP/GRP78 genome, and detected mutant efficiency by a restriction endonuclease digestion method. The results showed that target side (GGTCGAAGTCTTCTCCGCCC) of BiP/GRP78 gene had no mutant efficiency. The mutant efficiency of CD73 gene target side (GGACG CAGGAGACCAGTTCC)was nearly 20%, but there was no germline transmission in FO zebrafish. And the mutant efficiency of CD73 another target side (GGTGG ATCTCCGCGACACTC) was nearly 50%, there was germline transmission in its FO zebrafish. Fl embryos were raising to adults so as to detect their mutant types.Conclusions1、The method that zebrafish liver fibrosis model is established by DEN is stable and reliable, and this model will be a useful tool for investigating the liver fibrosis pathogenesis and performing high-throughput screening of potentially therapeutic drugs.2、Preliminary study of zebrafish hepatic fibrosis pathogenesis shows that CD73 and autophagy pathway mediated by ER stress may be involved in the development of zebrafish DEN-induced hepatic fibrosis, which will provide directions for further studying fibrosis pathogenesis.3、CD73 gene mutant FO zebrafish with germline transmission have obtained by using CRISPR/Cas9 system, and its progeny F1 zebrafish having a potential CD73 gene mutation are raising. The zebrafish mutant will provide a stable and reliable model organism for new drugs research and screening. |
PDF Full Text Request