| Background and objectives:Hepatocellular carcinoma (HCC) is one of the most common malignant tumors, ranking in No.6. In 2000, liver cancer reportedly has about 564,0 00 new cases, including 398,364 males and 165,972 females. More importa ntly, the incidence rate of liver cancer shows an upward trend in recent ye ars. The liver cancer has become one of the most primary cause of death i n patients with HBV/HCV infection. By scanning the distribution, the high incidence areas of liver cancer concentrates in East Asia, Southeast Asia an d parts of Africa. There is large number of liver cancer cases in China. A bout 356000 new cases in 2011 and the incidence of the disease is 26.39/1 00000. From 2000 to 2011, the incidence of liver cancer increased 1% pe r year on average in China. That’s to say, the incidence of liver cancer is still on the rise.The pathogenesis of HCC is complicated. It is not only affected by ex ternal environment, but also significantly related to internal gene factors. At present, pathogenesis of liver cancer is thought to be a synergism process with multi stages and multi factors, involving procedures of initiation, prom otion, progression and etc. There are multi cancer genes and related genes participating in the pathogenesis. Chronic liver injury caused by mutations i n multi genes and excessive immunity are the causes in pathogenesis. Chr onic hepatitis virus infection is the main cause of primary hepatic carcinom a. This carcinoma is mainly caused by the synergism of Acute or chronic hepatitis, cirrhosis and other cancer promoting factors on these basis. The HBV and HCV have particularly close relationship with liver cancer. In 19 70s, it was found that the incidence of liver cancer shared the same distrib ution with chronic HBV infection. Meanwhile, pathologic observation shows that chronic hepatitis is often found in non cancerous tissue surrounding li ver cancer. The carcinogenic mechanism of HBV has not been fully proved at present. The result of in vitro experiment shows that hepatitis virus inf ection can’t cause cellular immortalization or malignant transformation. Ther efore, the conclusion with the highest recognized degree is that cell prolifer ation is activated by inflammatory reaction. Then cell proliferation caused b y this inflammatory necrosis significantly increases the probability of DNA mutation. Moreover, active macrophages recruited by inflammatory reaction produce large number of free radicals that will cause cell damage. The exp eriment shows that the major reason of liver cancer formation induced by diethylnitronamine (DEN) is chronic inflammatory reaction and abnormal re pair following inducing liver injury. In addiction, liver cancer can be induc ed by pollution in drinking water, alcoholism, substance with hepatotoxicity such as flavacol etc.Liver macrophages are located in hepatic sinus gap, they are the body’ s largest organization fixed group of macrophages. The main function of ku pffer’s cells is removed by phagocytosis foreign matter from the portal circ ulation, with absorbing and degrading intracellular toxin. In addition, Kupffe r’s cells also can be used as antigen-presenting cells to present antigens and to secrete cytokines to induce T cells that begin to immune response. Liver virus infection and necrotic debris that were induced by chemical injury c an activate kupffer’s cells within the liver. After the immune activation, kup ffer’s cells through its pattern recognition receptors located on its surface (s uch as toll-like receptors) to combine PAMP located on the surface of the immunogen (pathogen associated molecular patterns), and then change the p henotype and consuming activity by itself, with the release of superoxide a nion and hydrogen peroxide, nitric oxide, hydrolytic enzymes and arachidon ic acid and so on to help destroy antigens. Meanwhile macrophages also se cret cytokines related to immunity and inflammation, such as interleukin 1, interleukin 6 and tumor necrosis factor TNF alpha, platelet activation of tra nscription factors, growth factors, interferon-gamma, etc.Chronic inflammator y response mediated by kupffer cells play an important role in chronic live r damage and repair caused by all kinds of chemical drugs and infection, a nd have directly relationship with primary hepatocellular carcinoma. There a re a number of kupffer cells in liver tissue under the persistent infection of hepatitis B, hepatitis C virus. Liver damage caused by hepatitis virus and chemical substance, liver cirrhosis, and primary hepatocellular carcinoma ass ociated closely with kupffer cells. In addition, in the course of liver damag e, regenerative repair, liver cirrhosis and primary hepatocellular carcinoma c aused by DEN, kupffer cells also have a crucial role. So, it is necessary to study the mechanism of hepatocellular carcinoma from the perspective of t he kupffer’s cells. This study focuses on the macrophages.TIP30 is a kind of Tat (Transactivator of transcription) interactive prote in with a molecular weight of 30 KD, and also RNA polymerase II bindin g protein, which can phosphorylate the largest subunits of RNA polymerase Ⅱ, a seven-peptide repeated sequence at the CTD (carboxyl-terminal doma in), specific to regulate the transcription of gene. TIP30 also can be regard ed as the special coactivator to promote the forming of Tat-Ⅱ RNA polym erase holoenzyme compounds, then cause a series of biological functions. It is also called HTATIP2 (HIV-1 interactive protein2), since it can improve the HIV-1 proliferation regulatory proteins Tat, specifically. As the research is gradually in depth, the multiple functions that can regulate cellular dama ge repair, adjust the cell’s glucose tolerance, regulate molecular transport in the cytoplasm, etc, also have been found. Earlier studies found that TIP30 gene is involved in development of tumor as a tumor suppressor gene. Th ere are visible decreases of TIP30 expression can be seen at a series of m alignant tumors, such as lung cancer, gastric cancer, prostate cancer, breast cancer, colon cancer and others. Many studies have shown that TIP30 gene knocked out can induce the tumors in body, such as liver cancer, lung ca ncer, ovarian cancer, leiomyoma, and bladder cancer, etc.According to the our previous studies in this research project, It is cle ared that the TIP30 gene has been knocked out could inhibit the occurrenc e of liver tumors in mice induced by DEN, it isn’t meet the usual perform ance that play a role of cancer suppressor gene. The effect has a relationship of down-regulating the activity of NF-kappa B/IL-6/STAT3 signaling pathwa y relating to inflammatory response. Further experiments have shown that t he mice without TIP30 gene macrophage infiltration in the liver significantl y less than the wild type mice after injecting DEN, intrahepatic Monocyte chemotactic protein-1 mRNA expression level is obviously lower than the wild type mice. Accordingly, TIP30 knocked out can inhibit primary the pr oduce of liver cancer induced by DEN may be associated with reduced infl ammation and liver fibrosis that cause of the decrease of the macrophage migration infiltration by the TIP30 reduced, relating to inflammatory respon se.However, wether the TIP30 gene knocked down is related to with NF-kappa B/IL-6 in macrophage? Why the TIP30 gene knocked down can caus e the decrease of migration of macrophage infiltration? The series of proble ms have not been solved. In this study, on the basis of preliminary experi ment, the research of macrophages should be taken as the main subject of study, the purpose is to clarify a possible mechanism that primary liver can cer incidence of the mice without TIP30 gene less than the wild type mice significantly after induced by DEN. It is necessary to explore the molecul ar basis of the correlation of TIP30 gene knocked down and intrahepatic m acrophages infiltration. Further found that TIP30’s new function and then cl arify the molecular mechanism of the primary liver cancer. The result can provide a theoretical basis of finding the new target in liver tumors in the future.Methods:1. The lentiviral vector expressing TIP30 shRNA transfect RAW264.7.Three different target sequence of shRNA was designed for a specific silence to TIP30 gene. Puromycin was used to further screen the aim cells and the situation of transfection was revealed by immunofluorescence stain ing under laser scanning confocal microscopy. Extracting RAW264.7 cell pr otein and then using Western Blot to detect protein expression of TIP30. In this way, the most maximum inhibiting rate of TIP30 protein of RAW264. 7 was selected to perform follow-up study.2. Western BlotCollecting cells and lysed in RIPA buffer (containing 2ul PMSF) at 4℃ for 20min. Lysates were centrifuged at 12000r/min for 20min. BCA Protei n Assay Kit was used to detect the concentration of the supernatant before adding moderate volume of 5 X loading buffer and then boiled the supernat ant for protein degenation. Protein samples were electrophoresed by SDS-P AGE, transferred to PVDF membranes, blocked with 5% skim milk, incuba ted with appropriate concentration of primary antibodies at 4℃ and kept ov ernight. The next day, secondary antibody was incubated before and after w ashing the membranes and then the membranes were exposed and analysed. The method is applied to investigate the protein of NFκB and p-NFκB.3. Realtime fluorescence quantitative PCR (polymerase chain reaction)Trizol reagent was used to extract RNA of RAW264.7 and then splitte d phase by chloroform, precipitated by isopropyl alcohol, washed by 75% a lcohol and resoluted by DEPC treated water. Extracted RNA need to be det ermined the purification and adjusted the concentration. The method was us ed to detect the change of IL-6 mRNA and ERa mRNA. According to the instruction of TakaRa Kit, cDNAs were reversely transcripted from mRNA. The primer sequences used were as follows:IL-6:forward:5’-AGAGGAG ACTTCACAGAGGAT-3’, reverse:TACTCCAGGTAGCTATGGTAC; ERa:fo rward:5’-AGGCGGCATACGGAAAGAC-3’, reverse:5"-CATTTCGGCCTTCC AAGTCA-3’;β-actin:forward:5’-TGCTGTCCCTGTATGCCTCT-3’, reverse: 5’-TTGATGTCACGCACGATTTC-3’.PCR amplification was performed by Roche LightCycler 480 and then analysing the results. The relative mRNA levels between experimental and control samples were detected by method of 2-Δ ΔCt, relative expression is 2-0Ce exPerimental samplel -Ct cotrol sample)), Grap hPad Prism 5.0 was used to draw graph.4. The method of mouse tail lysis identify mouse’s gene.C57 strain mouses whose genotypes are TIP30-/- were obtained from T he Jackson Laboratory (strain:B6.129P2-Htatip2tm1Hx/J). These mouses w ere cross-bred with C57 wild-type mice. The mouse tails of their two week s old descendant were cutted about 2mm to identify their genotypes. Mouse tail lysis solution (containing proteinase K) was added into EP tubes with mouse tail. After taking water bath and boiling samples, Lysates were centr ifuged at 12000r/min for 2min, and the supernatant fluid is the DNA templ ate. The TIP30 primer sequences used to identify genotypes were as follow s:Mutant Reverse:GGCCTCTTCGCTATTACGC; Common:TGAGTCTCT TCTGCCCAACA; Wild Type Reverse:TAATGGACACCTTCCCCTCA. Ord inary PCR and DNA agarose gel electrophoresis were carried out and analy zing the results after exposure.5. Extracting supernatant of mouse liver tissueAfter anesthetize the TIP30-/- or TIPS0V+/+ mouse, liver was removed, ri nsed in the clean bench. The liver tissue was weighed equally with electro nic balance, cutted up for 20min, homogenized and then centrifuged three-fi ve times at 12000r/min for 20min until the liquid is clear. The liquid is th e homogenate of mouse liver tissue including chemokine, including MCP-1.6. Transwell migration assayThe 8 μm pore transwell filters were used to perform the research. RA W264.7 cells were added to upper chamer and cultured with serum-free D MEM containing 2×105cells each chamber. According to different needs, D MEM including different chemokine was added into lower chamber. The ch ambers were incubated at 37℃ in 5% CO2 for 12 hours, and then the upp er chamber was removed the cells, fixed by dried methyl alcohol, dried, dy ed with 0.1% crystal violet for 30min. Cells that had migrated into the low er chamber were taked pictures, counted using microscope at random eight vision and then analyzed statistically.7. Chromatin Immunoprecipitation(CHIP)The bioinformatics analysis was applied to analyze the possible binding sites of SP-1 and MCP-1 promoter and designed the suitable primers used for the PCR analysis. According to the instruction of the Pierce kits, the Chi P assay was carried out and then verified by fluorogenic quantitative PCR.8. Statistical analysisData were analysed with SPSS 20.0 and expressed as mean±standard (x±s). Comparisons of two groups or more groups mean values were analys eed by independent sampe t test or One-way ANOVA followed by LSD or Dunnett multiple comparison tests. P-values were considered to be signific ant at<0.05.Results:1. TIP30 shRNA-2 is the most efficient fragments in interfering RAW2 64.7 cell. Lentivirus packaging TIP30 shRNA transfection RAW264.7 cell, i mmunofluorescence confirms that all groups have been transferred to target sequence. The efficiency of TIP30 shRNA interference were been detected by western blot experiments, the results show that the virus package TIP30 shRNA-2 interference TIP30 expression level decreased significantly in the NC group (P<0.001), and TIP30shRNA-A interference group and NC group have no significant difference (P>0.05), as well as TIP30shRNA-C. So TI P30shRNA-B interference group was selected with cell lines as the experim ental group of subsequent experiments of cell lines.2. TIP30 gene knockdown will down-regulate p-NFkappaB and the exp ression of IL-6:immunoblotting analysis reveal that TIP30 gene knockdown RAW264.7 cells expressed lower significantly p-NF kappa B protein than t hat of wild type RAW264.7 cells (P<0.05), and the expression of NF kapp a B have no significant difference (P>0.05). Fluorescence quantitative PCR detection of IL-6 mRNA level, IL-6 mRNA level in RAW264.7 cells TIP30 gene knockdown lower than the wild type RAW264.7 cells (P<0.05).3. The TIP30 gene knockdown can increase the expression of estrogen receptor (ER alpha):by using fluorescence quantitative PCR, ER alpha m RNA expression level were detected, the expression of ER alpha mRNA in TIP30 gene silencing macrophage RAW264.7 is 1.77 times that of the wil d type RAW264.7 cells (P<0.05).4. The reducing of TIP30 gene inhibit not only the migration ability o f macrophage itself but also the secretion of chemokine, such as MCP-1, a nd then reduce the migration and infiltrating ability of macrophage:it has proved by transwell experiment that the liver homogenate from the TIP307-genotype mice added into lower chamber had lower migratory macrophages than that from the TIP30 +/+ genotype mice when the cells of upper cham ber are identical (P=0.01). When the lower upper was added same chemoki ne, the RAW264.7 cells disturbed by TIP30 shRNA-2 had less migratory m acrophages than NC group in the upper chamber (P<0.05).5. TIP30 protein combined with promoter region of MCP-1 promoter r egion, but not SP-1 which has been known as the upstream molecular of MCP-1:chromatin immunoprecipitation assay have confirmed that TIP30 ca n combine with MCP-1 gene, regulate its downstream genes and then have direct influence on the migration of macrophage. Moreover, TIP30 have n of indirect influence on the migration of macrophage by combining with SP-1 promoter region.Conclusion:Combined with the previous research outcomes, the reasons of TIP30 gene knockout mice had the lower morbidity of liver cancer induced by D EN may be as follows:1. The reducing of TIP30 gene will increase the level of estrogen rece ptor α(ERα) and then decrease p-NFκB, subsequently inhibit the secretion o f IL-6, and then reducing the activation of STAT3 in liver cells, which res ults in inhibiting the differentiation and proliferation of liver cells.2. The decreasing of TIP30 gene will reduce the expression of Monoc yte chemotactic protein-1(MCP-1) that combined with TIP30. Meanwhile the abilities of migration and infiltration of macrophage itself will decrease, an d then lead to reducing the infiltration of macrophage in liver tissue, inhibi ting chronic inflammative reaction and hepatic fibrosis related to it, resultin g in decreasing morbidity of liver cancer. |
PDF Full Text Request