| Background and ObjectiveHBV infection is a worldwide health problem, the world has 240 million patients with chronic hepatitis B, there are more than 78 million people died of cirrhosis of the liver and liver complications of hepatitis B each year, according to the World Health Organization (WHO) 2015 published data. Current treatment for HBV is mainly dependent on interferon and nucleotide analogs, which can’t fully clean HBV and have many disadvantages, such as toxic side effects, easy rebound after withdrawal and potential drug resistance. The important role of microRNA in anti-HBV infection provides a new method to solve the infection. MiRNA is a class of about 22 nucleotides in length, non-coding single-stranded RNA molecule. The mature miRNA may form the RNA-induced silencing complex (RNA-induced silencing complex, RISC) to regulate gene post-transcriptionalion expression. Including normal physiological processes, miRNA aslo plays an important role in infection, tumor development, and other aspects of cardiovascular disease, which provides new breakthrough for the diagnosis and treatment of related diseases.Recent studies have found that although miR-21 is involved in repairing process after liver damage and promoting normal liver regeneration by increasing its expression after acute liver failure and partial liver resection, but its essence is a kind of cancer-promoting gene miRNA, involved in a variety of tumor cell proliferation, apoptosis and invasion. Especially, miR-21 plays an important role in the HBV and EBV infection induced cancers. Studies have shown that, miR-21 expression was elevated in liver cancer patients.miR-21 and HBx promote each other, both play an important role in liver cancer and HBV infection. The miR-21 expression was increased in HBV-related hepatocellular carcinoma (HCC), playing the role as cancer-promoting gene by inhibiting the expression of pro-apoptotic protein PTEN, Fas-L and so on. gene is one of the cancer-promoting genes that can bind DNA. C-myc can promote the proliferation of hepatoma cells through a variety of mechanisms, including HBx. Therefore, we may attempt to explore the role of miR-21 in HBV infection, and whether there is an association between miR-21 and c-myc in HBV-related HCC.miR-132 is also one of miRNAs that take part in bacterial infection and the pathogenesis of a variety of tumors. In the previous study, miR-132 mainly promote viral infection. High expression level of miR-132 may suppress macrophage transcriptional coactivator p300 expression, thereby reducing the secretion of IFN-γ (IFN-y). However, in HBV infection related HCC, the expression of miR-132 is inhibited by HBx and low expression level of miR-132 may relate to HCC development, suggesting that the role of miR-132 in the HBV infection may be different with other viruses. In HCC, previous research has shown that miR-132 inhibit cancer cell proliferation by Akt/mTOR signaling pathway and the Yes-associated protein (YAP). The PTEN (phosphatase and tensin homolog deleted on chromosome ten) is the Akt signaling pathway upstream factor, which expression is decreased in the development of HCC. Targetscan forecast data prompts that PTEN is one of the gene targets of miR-132. Therefore, this study attempts to further clarify the a role of miR-132 in chronic HBV infection, as well as PTEN gene expression.Methods1. The construction of pmR-21 and pmR-132 eukaryotic expression restructured vectorOligo7 software was applied to design primers based on the pre-miR-21/pre-miR-132 sequences and their upstream and downstream flanking 100bp sequences founded in the miRBase database. Then the precursor sequences were amplified by PCR,using the DNA,which extracted from HepG2.2.15 cells, as the template. After double digestion, the purified PCR products were connected to pmR-mCherry plasmid using T4 ligase at 16℃ overnight. After connecting, the product was transformed into E. coli DH5a, under kanamycin-resistant screening. The positive colonies were picked after 16 hours and expanded cultured to extract plasmid, which was tested by 1% agarose gel electrophoresis to preliminary identified the correctness of the recombinant vector. Finally, selected the positive group to test the sequences.2. The transfection of the recombinant vectorHepG2.2.15 cells were cultured in 15% FBS high glucose DMEM medium (adding 200 mg/L of G418,10 g/L L-glutamine and 100000 IU/L penicillin-streptomycin), HegG2 cell were cultured in culture high glucose DMEM containing 10% FBS and 100000 IU/L of penicillin-streptomycin. Cells were maintained in an atmosphere of 5% CO2 in a humidified 37℃ incubator. The endotoxin free recombinant vector and empty pmR-mCherry were transfected into HepG2.2.15/HepG2cells, according to the manufacturer’s instructions. The cells were divided into pmR-21/pmR-132 recombinant vector group, empty vector group and control group, HepG2 positive control group.24h after transfection, the fluorescent protein was observed under the fluorescence microscope. All transfection experiments were done in duplicates and repeated at least three times.3. Transfection efficiency detected by flow cytometry24h after transfection, cells were trypsinized and washed three times with PBS. The flow cytometry was performed on 480/620nm, blank group was taken as the control wells.4. miR-21 and miR-132 relative quantification by qPCR24h after transfection, cells were collected to extracted total RNA, the integrity of RNA was detected by 1% agarose gel electrophoresis. Took the RNA as templates, designed specific stem-loop RT-PCR primers for miR-21 and miR-132 mature sequence (designed and synthesized by the Guangzhou Rui Bo biotech companies), performed qPCR after reverse transcription, with U6 as an internal control. The relative expression of miR-21/miR-132 was analyzed by 2-ΔΔct.5. HBsAg and HBeAg detected by chemiluminescenceThe culture supernatants (except the positive control group) was collected 24h-48h-72h after transfection,1500rpm centrifugal 5min, then the chemiluminescence immunoassay was performed to detected supernatant.6. The copies of HBV DNA in the culture supernatantsThe culture supernatants (except the positive control group) was collected 24h-48h-72h after transfection, the copies of HBV DNA was detected by quantitative PCR according to kit instructions.7. c-myc mRNA levels detected by RT-PCRThe total RNA was transcribed into cDNA as a template for PCR amplification. The upstream primer was CGTCCTCGGATTCTCTGCTC, the downstream primer was GCTGGTGCATTTTCGGTTGT. Took GAPDH as internal control, the upstream primer was:GCTCTCTGCTCCTCCTGT, downstream primer was: ATGAGTCCTTCCACGATAC. Gray value of the bands were analyzed after 2% agarose gel electrophoresis.8. PTEN mRNA levels detected by RT-PCRThe total RNA was transcribed into cDNA as a template for PCR amplification. The upstream primer was GGGGTGGAACTGTGCACTAA, the downstream primer was TAGGCTTTGAAGGACAGCAGG. Took GAPDH as internal control as above. Gray value of the bands were analyzed after 2% agarose gel electrophoresis.9.c-myc/PTEN protein levels detected by western blotProtein samples which concentration were detected by BCA method,were extracted 72 hours after transfection.Then adjust the concentration of each protein samples to be equal before denaturation. The proteins were thentransferred onto polyvinylidene fluoride membranes. After incubation with antibodies specific against c-myc/PTEN/ β-actin,the blots were incubated with goat anti-rabbit secondary antibody and visualized using enhanced chemiluminescence.10. CCK-8 cell proliferation assay24h after transfection cells were treated with trypsin and inoculated into a 96-wells plate:1000 cells per well, with 200ul culture medium,8 wells for each group. Cell proliferation was detected respectively from 1 to 4 days:cells were treated with CCK-8 for 1.5h, and optical density(OD) was read on a spectrophotometer at 450 nm. Drew growth curve according to the result.11. Statistical analysisData are presented as the mean±standard deviation. Data analysis was done by Prism 5 and SPSS 20. t-test was performed to compared differences between the two groups, one-way ANOVA was performed to compared differences among multiple groups.p<0.05 was regarded as significant.Results1. verification of the recombinant plasmidAfter ECOR I and BamH I digestion, plasmid fragments and inserted fragments were visible. The small fragments of pmR-21 recombinant vector located between 300bp and 500bp, while the small fragments of pmR-132 recombinant vector located between 500bp and 750bp, which were consistent with pre-mir-21, pre-miR-132 PCR product sizes. Finally sequencing confirmed pre-miR-21, pre-miR-132 fragments had been inserted pmR-mCherry plasmid, the two recombinant vector was successfully constructed.2.The expression of fluorescent proteinCells in each group were morphologically normal. Fluorescence was observed in pmR-21 and pmR-132 recombinant vector group, vector group while the blank group had no fluorescence. Transfection efficiency was greater than 50%,detected by flow cytometry.3.Relative expression of miR-21The relative expression amount of miR-21 in the pmR-21 recombinant vector group (18.88±2.35) was higher than that in the empty vector group (1.01±0.11), P<0.01. No difference between empty and blank groups.4.Relative expression of miR-132The relative expression amount of miR-132 in the pmR-132 recombinant vector group (20.10±2.29) was higher than that in the empty vector group (0.97±0.11), P<0.01. No difference between empty and blank groups.5. HBsAg and HBeAg in the cell culture supernatantHBsAg and HBeAg of pmR-21 transfection group was higher than that of empty vector group and blank group (P< 0.05), and empty vector group and blank group had no statistical difference (P> 0.05); HBsAg and HBeAg of pmR-132 transfection group was lower than that of empty vector group and blank group (P< 0.05), and empty vector group and blank group had no statistical difference (P> 0.05).6. HBV DNA copies in cell culture supernatantAfter transfection 24h,48h,72h, HBV DNA of pmR-21 group cell culture supernatant copies were higher than that of empty vector group and blank group (P< 0.05), empty vector group and blank group had no statistical difference (P> 0.05).While pmR-132 recombinant vector group HBV DNA copies were lower than the empty vector group and blank control group, P< 0.01. No difference between empty group and blank group, P>0.05.7.c-myc mRNA expression after transfection24 hours after transfection, while the expressions of internal control gene were equal in each group, the expression of c-myc mRNA in pmR-21 recombinant vector group was higher than that in the blank group and empty vector group group, P<0.05.9.PTEN mRNA expression after transfection24 hours after transfection, while the expressions of internal control gene were equal in each group, the expression of PTEN mRNA in pmR-132 recombinant vector group was higher than that in the blank group and empty vector group group, P<0.05.8. c-myc protein expression after transfectionWestern blot showed that the expression of c-myc in pmR-21 recombinant vector group was higher than empty vector group and control group (P<0.05),72h after transfection.10. PTEN protein expression after transfectionWestern blot showed that the expression of PTEN in pmR-132 recombinant vector group was higher than empty vector group and control group (P<0.05),72h after transfection.11. cells proliferation after transfectionAfter transfection, pmR-21 recombinant vector group cell grew faster than the empty vector group and control group (P<0.05); pmR-132 cell proliferation grew slower than empty vector group and control group (P<0.05).Conclusions1.The pmR-21 and pmR-132 eukaryotic expression restructured vectors were successfully constructed.2. In HepG2.2.15 cells, miR-21 can promote the replication and expression of HBV, promote the expression of c-myc and accelerate cell proliferation.3. In HepG2.2.15 cells, miR-132 can inhibit the replication and expression of HBV, enhance the expression of PTEN and inhibit cell proliferation. |
PDF Full Text Request