Constructing Of Mutant Library And Cloning Of Genes Involved In Phaseolotoxin Synthesis In Pseudomonas Syringae Pv. Actinidiae | Posted on:2016-12-25 | Degree:Master | Type:Thesis | Country:China | Candidate:J H Yu | Full Text:PDF | GTID:2323330482482089 | Subject:Plant pathology | Abstract/Summary: | PDF Full Text Request | Kiwifruit bacterial canker disease is a devastating bacterial disease to kiwifruit production.At present,kiwifruit bacterial canker occurs seriously in Italy,New Zealand,China etc,and restricts the development of Kiwifruit industry.Pseudomonas syringae pv.actinidiae is the causal agent of bacterial canker of kiwifruit.A key component in the development of the disease is phaseolotoxin.However,the effect of the toxin on pathogenic mechanism of kiwifruit bacterial canker is not yet clear.Therefore,we construct of mutant library by transposon mutagenesis and gain the Tox-mutants.Genes to phaseolotoxin synthesis are cloned and definite in the function.Our purpose is to lay the foundation for revealing the pathogenetic mechanism of phaseolotoxin toxin.The research contents are as follows:1.Construction of Tn5 mutant library from Pseudomonas syringae pv.actinidiae.In this experiment,using Pseudomonas syringae pv.actinidiae AHP18 which is produce phaseolotoxin as material.EZ-Tn5 carrying kanamyc in resistance gene marker was inserted into genome of Pseudomonas syringae pv.actinidiae by electroporation on the condition of 1200 V/cm 5 ms to construct Tn5 mutant library.A total,we gained 254 mutant strains.In the LB plates that contain kanamyc 50 ?g/mL,picking mutant randomly and continue to culture 7 generations in order to initially identify Tn5 insert into the genome of AHP18 steadily.2.Screening of the Tox-mutants.According to the obtained optimal phaseolotoxin production system,M9 medium was inoculated with the wild-type strain and mutants to obtain an initial optical density at 600 nm of 0.1 and incubated at 18 ?.Supernatants were collected after 48 h and used for the E.coli growth inhibition assay.19Tox-mutants we had screened initially.In order to confirm the Tox-mutants,we used freeze drying concentration of crude toxin to test E.coli growth inhibition and TLC.In final,we screened 6 mutant strains which are complete loss of phaseolotoxin and phaseolotoxin toxin producing weak mutant.3.Identification of the Tox-mutants.Using reported primers PsaF1/PsaR2,PsaF3/PsaR4 to do the dual PCR for the mutant strains.Gel electrophoresis appeared two bands in the 175 bp and 280 bp.So verify the mutant was derived from the wild type strain.According to the specific region of EZ-Tn5 transposon,EZ-Tn5F(AGATGTAGGTGTTCCACAGGGTAG)/ EZ-Tn5R(AACATCATTGGCAAC GCTACCT)were designed as the transposon specific primers.Transposon PCR obtained a1060 bp fragment.Determined the EZ-Tn5 inserted into the genome of the Tox-mutants stably.4.Cloning of genes of insertional inactivation and analysis the sequence.According to the sequence of the ends of the transposon EZ-Tn5,3 pairs of nested primers were designed.According to the conserved amino acid sequences from common species of protein,arbitrary degenerate primers were designed.Amplification of flanking sequences of the transposon insertion sites used TAIL-PCR method.2 Tox-mutants AHP1846 and AHP1879 genomic DNA were as template.The results showed that using the left primers LSP1,LSP2,LSP3 got a sequence of 293 bp from AHP1846 genome.To determine the Tox-mutants of Tn5 insertion site,using DNAStar,DNAMAN and BLAST on the NCBI sites to analyze the homology sequence of the flanking sequences.The result was that the flanking sequence has 100% homology with the published glmS gene of P.syringae pv.actinidiae.The gene encoding L-glutamine:D-fructose-6-phosphate aminotransferase(shorter from GFAT).Primers GF/GR were designed according to the conserved regions of glmS gene published in kiwifruit bacterial canker and other gram negative bacteria.The wild type strain AHP18 genome DNA as the template.We got a sequence of 1836 bp.The result was that the sequence had 100% homology with the published glmS gene of P.syringae pv.actinidiae.Determine the position of flanking sequence was located at the glmS gene916-1133.In order to verify the EZ-Tn5 copy number in AHP1846 genome,we used Southern hybridization to analysis.According to the transposon,we designed primers TZF/TZR.The probe was labeled by digoxigenin.Genome DNA of AHP1846 was digested by restriction endonuclease Hind III.The result of Southern hybridization was that we got a single band,indicated that EZ-Tn5 transposon in the genome of AHP1846 was a single copy.5.The effect of the gene which was inactivated by transposon insert on the pathogenicity of kiwifruit bacterial canker.TOX-mutants AHP1846 and AHP1879 and wild type strain AHP18 were inoculated to tobacco leaves by acupuncture injection.The result showed that the insert gene inactivation mutant strain AHP1846 and mutant strain AHP1879 had no hypersensitive response to tobacco leaves,while the wild type strain AHP18 had hypersensitive response to tobacco leaves.TOX-mutants AHP1846 and AHP1879 and wild type strain AHP18 were inoculated to kiwifruit leaves in vitro and vivo by friction.The result showed that the insert gene inactivation mutant strain AHP1846 and mutant strain AHP1879 had loss the pathogenicity to kiwifruit leaves,while the wild type strain AHP18 showed the typical brown spot on kiwifruit leaves.TOX-mutants AHP1846 and AHP1879 and wild type strain AHP18 were inoculated to kiwifruit twigs in vitro and vivo by wound.The result showed that the insert gene inactivation mutant strain AHP1846 and mutant strain AHP1879 had loss the pathogenicity to kiwifruit twigs,while the wild type strain AHP18 showed brown at the site of inoculation.The gene which was inactivated by transposon insert in AHP1846 had effect on the pathogenicity of kiwifruit bacterial canker.Losing the function of the glmS gene may lead kiwifruit bacterial canker loss the pathogenicity. | Keywords/Search Tags: | P.syringae pv.actinidiae, electroporation, EZ-Tn5 insertion mutagensis, phaseolotoxin, pathogenicity | PDF Full Text Request | Related items |
| |
|