Expression, Purification And Functional Identification Of Fc/psBAFF Fusion Proteins And Their Mutants

B-cell-activating factor(BAFF),a member of tumor necrosis factor(TNF)family,have been implicated as growth and survival factors for mouse B splenocytes.It has a crucial role in both humoral and cellular inununity.In November 2000,due to the specific bioactivity of BAFF in raising the immunity,the recombinant soluble(sBAFF)has already been approved as an orphan drug to enter Phase I clinical trial studies for the treatment of patients with immunoglobulin-A(IgA)deficiency and common variable immunodeficiency(CVID).Lots of experiments has showed that certain recombinant cytokines(such as CD40L and IL-2)as immunoadjuvants with vaccines can significantly improve the effectiveness of vaccine,and could improve animal diseases on resistance.It also can overcome the side-effects of traditional medicines(antibiotics and chemical drugs).BAFF could promote antibody secretion and stimulate proliferation of activated B-cells,indicating that it might have an adjuvant-like effect on the immune system to boost immunity as same as CD40L and IL-2.Thus,BAFF,is always the hot topic of research since it was found,but there are no reports on the molecular cloning,characterization and immunoadjuvant effect research of sBAFF and sBAFF mutant of important economic animals.In our study,to ameliorate the activity of psBAFF on mouse B splenocytes,here we constructed a novel fusion protein consisting of Fc fragment and psBAFF(Fc/psBAFF)and took Fc/psBAFF as template,sites one-step opposite orientation PCR was used to construct the mutant Ec/psBAFF(Fc/pmBAFF)DNAs(in which GTCCATGTCTTTGGGGATGAACTG replaced by GGGGGG),after inserting Fc/psBAFF and Fc/pmBAFF into pET28a Vector respectively,the recombinant proteins were efficiently expressed in E.coliBL21(DE3)and easily purified by Protein A chromatography。Finally,to assay the immunological functions of Fc/psBAFF and Fc/pmBAFF,laser scanning confocal microscopy,flow cytometry and methyl thiazolyl tetrazolium were employed.Results demonstrated that Fc/psBAFF protein retained the activity of promoted porcine B lymphocyte survival in vitro.Moreover,the function of Fc/pmBAFF was stronger than Fc/psBAFF.