Font Size: a A A

Study On Reduction Of Off-target Efficiency By Truncated GRNA At Bovine MSTN Locus

Posted on:2019-07-16Degree:MasterType:Thesis
Country:ChinaCandidate:Z LiFull Text:PDF
GTID:2370330563457183Subject:Bio-engineering
Abstract/Summary:PDF Full Text Request
Myostatin(MSTN),also known as GDF-8,is a member of the TGF-p superfamily and is discovered in 1997 as a negative regulator associated with skeletal muscle growth and development.Losing its activities will cause excessive muscles development,which manifested as double-muscle traits.The CRISPR/Cas9 technology is a technique that enables the Cas9 endonuclease to specifically recognize gene target sites by gRNA and perform gene editing.CRISPR/Cas9 technology has many advantages,but it also has the disadvantage of off-target.The CRISPR/Cas9 vector used in this experiment is called CRISPR/Cas9-B,which is a g RNA designed for recognizing the second exon of bovine MSTN gene.This gRNA guides the Cas9 protein to act on the AGAACCAGGAGAAGATGGAC TGG site.However,we discovered the 5’ end of the receptor-type tyrosine-protein phosphatase N2 in chromosome 4 has a 17 bp identical site with gRNA.The 5’ end of leukocyte immunoglobulin-like receptor has a 14 bp identical site to that of gRNA,and the 5’ end of chromosome 10 of kinectin isoform X7 has a 16 bp identical site to that of gRNA by blast search.These sites are the potential off target sites of CRISPR/Cas9-B.To detect the off-target rates,the primers are designed at both ends of these sites for PCR analysis.To reduce the CRISPR/Cas9 off-target efficiency,we truncated the gRNAs by 1bp,2bp,3bp,and 5bp,and reconstructed CRISPR/Cas9 plasmids named as CRISPR/Cas9-19,CRISPR/Cas9-18,CRISPR/Cas9-17 and CRISPR/Cas9-15 respectively.All this plasmids were electroporated into bovine fetal fibroblasts,respectively.The single-cells were collected by flow cytometry and cultured in 96-well plates to obtain the cell lines.The genomic DNA of the cell lines was extracted and then used for PCR amplification and electrophoresis analyses.Subsequently,the PCR products were sent for sequencing.Results showed the efficiencies of CRISPR/Cas-B,CRISPR/Cas9-19,CRISPR/Cas9-18,CRISPR/Cas9-17,and CRISPR/Cas9-15 for the MSTN target sites is 66.16%,17.39%,7.69%,74.29% and 3.85%.The efficiency of the off-target on chromosome 4(primer 2)was 52.86%,0,0,8.82%,and 0,respectively.The efficiency of the off-target on chromosome 1(primer 9)was 44.87%,51.72%,86.36%,0,and 50%,respectively.The efficiency of chromosome 10 off-target(primary 26)was zero.We found that targeting efficiency of CRISPR/Cas9-17 plasmid at the MSTN gene was higher than CRISPR/Cas9-B.At the same time,the efficiency of the three designed off-target sites was significantly reduced and statistically significant.The CRISPR/Cas9-17 plasmid achieves the goal of reducing off-target efficiency while not affecting target gene targeting efficiency.This study not only successfully knocked out the MSTN gene in bovine fetal fibroblasts,but also improved the off-target problem of the CRISPR/Cas9 technology by shortening the length of the gRNA,and enabled the CRISPR/Cas9 technology to play a better role in the breeding of cattle and sheep.
Keywords/Search Tags:CRISPR/Cas9, gRNA, Target site, Off-target
PDF Full Text Request
Related items