Font Size: a A A

Establishment And Application Of Multiplex PCR Detection Method For A/B/J Subgroup Of Avian Leukosis Virus

Posted on:2020-10-22Degree:MasterType:Thesis
Country:ChinaCandidate:M Z ZhangFull Text:PDF
GTID:2370330575977610Subject:Veterinary Medicine
Abstract/Summary:PDF Full Text Request
Avian leukosis is a kind of tumor diseases caused by avian leukosis virus of retroviridae,which is mainly caused by avian leukosis virus of avian retrovirus.Susceptible chickens can be transmitted in both horizontal and vertical ways.ALV may cause the chicken to grow slowly,the egg quantity to drop,the hatching rate is low,the death rate increases and other adverse reactions appear.The epidemic and outbreak of avian leukosis in recent years has caused serious economic losses to China’s poultry industry,the ALV was divided into A-J 10 subgroup according to virus interference pattern,host range and envelope glycoprotein difference,Chicken’s ALV contains 6 subgroups: A,B,C,D,E,J,Among them.The common exogenous ALV in commercial laying hens during the process of A and B subgroup;A is more prevalent than B and J,and J subpopulations are more infectious and pathogenic than A and B.Because A,B and J subgroups are of great significance in ALV,as for the prevention and control of ALV,there is no effective clinical ALV vaccine and drug,detection and elimination of virus-positive birds,control and pure population,is a more effective means to control the spread of ALV.Therefore,accurate,practical and efficient detection method is particularly important for the prevention and control of avian leukosis.At present,only IDXX ELISA kit is used to detect Avian Leukemia,which is expensive and difficult to classify.Therefore,this study established a simple,rapid and able to simultaneously detect A,B and J three subgroups of avian leukosis were detected by multiplex PCR.Three subgroups of A,B and J were sequenced and compared by website and software,and A common upstream primer was designed within the range of gp 85 sequences that were specific to each subgroup 5’-3’: GCCAAACGGATTTCTGCCTT,three different downstream primers,type A 5’-3’: AACCCAGATACCAAGGAACC,type B 5’-3’: GCCTCTGGTGGGAGAATCGT,type J 5’-3’: ATTGTTCCACAACACCTCTG.The four primers were then placed in the same PCR system and amplified to detect the three subtypes of A,B and J,375 bp fragments were amplified to detect subtype A,766 bp fragments were amplified to detect subtype B,683 bp fragments were amplified to detect subtype J.Then the detection system of the PCR detection method and the annealing temperature of the PCR program were optimized.The multiplex PCR assay can distinguish other subtypes of avian leukemia from common avian disease viruses,and has specificity.As the chicken industry in our province has many problems,such as uncontrolled introduction,the lack of standard test methods for avian leukosis typing and the proliferation of breeding process make the epidemic of avian leukosis in the region more complex and more extensive,and the epidemic gradually appears to be on the rise.In order to understand the epidemic situation of avian leukosis in our province,fill in the gaps in the epidemiological investigation of avian leukosis in our province,and provide the basis for the development of preventive measures and purification of avian leukosis,we have conducted epidemiological investigation on the representative areas where avian leukosis is more common in our province.A total of 1660 samples were sampled from 9 areas of Jilin Province.The infection rate of ALV was 57.71%,the highest infection rate was in Changchun,and the regional difference was not significant.The infection rate of ALV of commercial generation was higher than that of ancestral generation and parental generation in the sampling inspection process of ancestral generation,parental generation and commodity generation.The infections of three subgroup,J subgroups was much higher than that of A and B subgroups,There were mixed infections,mainly A and B subgroups.All these show that ALV infection is common in our province,and ALV-J infection rate is the highest,and the infection rate of chickens is related to feeding condition,breeding density,epidemic disease prevention and control level,purification cost and so on.
Keywords/Search Tags:Avian leukosi, Avian Leukosis Virus(ALV), Multiplex PCR, Epidemiological investigation
PDF Full Text Request
Related items