| Salmonella Enteritidis is the primary pathogen that causing acute gastroenteritis in human or livestock.It is a common foodborne pathogen,and the infectious symptoms include diarrhea,vomiting,fever and so on.The bacteria not only increase the morbidity and mortality of poultry and cause serious economic losses,but also harm to human health by carring the contaminated poultry products to human bodies.Statistics show that the number of cases of acute gastroenteritis caused by salmonella accounts for 40%~60% of the total number of food poisoning each year.In China,food poisoning caused by Salmonella has repeatedly ranked first.How to prevent and detect Salmonella enteritidis in food? has become an important topic of international public health.The traditional bacterial detection method has the disadvantages of low sensitivity,low accuracy,long detection period and cumbersome operation,which is not suitable for the application in the food field detection.Based on the current situation,it is imperative to develop a rapid detection method for Salmonella enteritidis.In recent years,the Systematic Evolution of Ligands by Experimental Enrichment(SELEX)based on aptamer exponential enrichment of Aptamer has been successfully applied to the actual sample detection in multiple fields.It has the advantages of wide range of target substances,good screening specificity,high affinity,short cycle,easy transportation and preservation,etc.SELEX is considered a potential alternative to antibodies.In this study,we aim to establish a rapid detection method for Salmonella enteritidis by screening the specific aptamers and surface of Salmonella,combining with the enhanced Raman spectroscopy technique.The research comprise two parts as following :(1)Screening and evaluation of whole-bacteria-SELEX(whole-bacteria Systematic Evolution of Ligands by Exponential Enrichment)specific aptamers of Salmonella enteritidis.Taking salmonella enteritdis as the target,the unbound ss DNA was isolated and incubated with a random oligonucleotide library.In order to obtain a high affinity and high specificity aptamer library,the combined ss DNA was enriched and screened for 15 rounds.We obtained the aptamer candidate sequences by monoclonal sequencing and secondary structure analysis.Then,the affinity of candidate aptamers was analyzed by enzyme-linked immunosorbent assay(ELISA)and flow cytometry.To obtain a high affinity for Salmonella enteritidis,the specificity of candidate aptamers was analyzed by the surface enhanced Raman spectroscopy.The aptamer sequence are as following: TTTTTGCGATCCAAGCTTCTTCAATTGGAGTGCTACCGAGATACATGGGTGG GCTCAAACAATCGTGGGCTCGCTTGATACTAGACTGCACATCT.(2)The establishment of surface enhanced Raman technique for rapid detection of Salmonella enteritidis.In the first step,the Salmonella enteritidis were incubated with folded specific aptamers,then washed to seperate the unconjugated and low binding aptamers.Secondly,in situ reduction of nano silver shell approach was carried out on the surface of the complex of Salmonella enteritidis and specific aptamer.Through the above procedures,the target bacteria can be detected quickly and intuitively by collecting the Raman spectrum signal on the surface of the complex.The whole-bacteria-SELEX technique was used to screen the specific aptamers of Salmonella Enteritidis,and the affinity and specificity of the aptamers were evaluated by ELISA and SERS techniques.To establish a method for detection of Salmonella Enteritidis.we did a validation test by combining aptamer4 with 5 other types of mixed bacteria,such as Salmonella enteritidis and Klebsiella pneumoniae.Results showed that it can be specifically detected by SERS technology.This method has a stable repeatability,and its minimum detection limit of bacterial concentration is 102 cfu/m L.We applied this new established method for detection of pork samples,the recovery rate of Salmonella enteritidis was ranged from 93.37% to 100.18%,a reasonable recovery rate as expected.It is proved that this method is fast,sensitive and accurate and can realize rapid detection in the process of food production,processing and transportation. |