Research And Development Of A Lateral Flow Biosensor For Rapid Detection Of Osteopontin

The rapid determination of human osteopontin(OPN),a potential cancer biomarker,holds substantial promise for point-of-care diagnostics and biomedical applications.At present,most OPN detection platforms rely on large instruments,and time-consuming,high cost.Therefore,we developed an OPN biosensor for lateral flow(LFB)by using isothermal chain replacement amplification technology(SDA),which is easy to carry and has the advantages of low cost.This study is divided into three parts:First,construct OPN side flow biosensor.It is consists of biotin modified aptamer,sample pad,conjugate pad,nitro fiber membrane and absorption pad.Second,the screening of nucleic acid aptamers and the labeling of biotin.Through screening,two suitable ligands for the experiment were obtained.One is captured aptamer(TGTGTGCGGCACTCCAGTCTGTTACGCCGCtagtccag aagccgaacaa),the other is amplified aptamer(TGTGTGCGGCACTCCAGTCTGTT ACGCCGCtagtccagaagccgaacaagctgagg ATGAAGAACAACGGCT).It was synthesized and labeled with biotin.Third,matching and verification of parameters.In the paper,the effects of concentration multiple,particle size,conjugate of different volumes of goldnanoparticles,magnetic beads and pad buffer of different p H samples on LFB were tested to determine the optimal experimental conditions.The biotin-modified aptamer was used for OPN recognition,then streptavidin(SA)-modified gold nanoparticles in the conjugation pad was used for different concentrations of OPN capture,and then the human OPN was immobilized in the test line for color development.Finally,the biosensor can detect the OPN as low as 0.1 ng m L-1 of OPN with a good dynamic detection between 10-500 ng m L-1 within 5 minutes.Although the sensitivity of enzyme-linked immunosorbent assay(ELISA)is also very high,the efficiency of this method is much higher than that of enzyme-linked immunosorbent assay(2 h).And the lateral flow biosensor can distinguish osteopontin from highly specific interfering proteins.Therefore,the biosensor is a promising alternative method for prevention and OPN detection for real samples.