The Expression Of SNX17 And LRP4 In Skeletal Muscle Cells

BackgroundLow-density lipoprotein receptor-related protein 4(LRP4)antibody is a newly discovered molecule that mediates the onset of myasthenia gravis(MG).MG is an autoimmune-mediated immune disease that has been recognized by many scholars and is caused by impaired synaptic transmission of neuromuscular junction(NMJ).80%of patients with MG can detect autoantibodies against the muscle nicotinic acetylcholine receptor(AChR)AChR,and about 20%of patients with MG are negative for acetylcholine receptor antibodies.Recently,LRP4 autoantibodies were found in 2-27%of patients without AChR and MuSK antibodies,and animal models suggested the pathogenic role of these antibodies.At present,studies on the repair mechanism of MG endplate membrane are rare.The experimental autoimmune myasthenia gravis(EAMG)is a reliable animal model for the study of MG and is an important tool for studying disease mechanisms and/or methods for treating the disease.MG has many similar immunopathological and clinical features,including the presence of anti-AChR antibodies in serum,deposition of IgG and complement on NMJ,and loss of muscle AChRs.At present,the EAMG model is commonly used to synthesize murine 97-116 poly AChR-?subunits(R97-116).Recently,SNX17 has been identified as a binding partner of several members of the Low-density lipoprotein(LDL)receptor family,and it is preventing?1 integrin and low-density lipoprotein receptors containing the NPxY motif.It plays an important role in the degradation of P-selectin lysosomes.In our previous study,we found that Sorting nexin 17(SNX17)was significantly increased in intercostal muscle cells of MG patients and was co-localized with AChR at NMJ,and co-immunoprecipitated(Co-IP).Western Blotting(WB)experiments verified that the prokaryotic expression of LRP4 intracellular domain protein and eukaryotic expression of SNX17 can be directly combined in vitro.It is speculated that LRP4 in the MG patients NMJ muscle cells through SNX17 binding,to avoid the dissolution of The degradation pathway of the enzymatic body was directly inserted into the cell membrane for recycling,and the LRP4-MuSK-nAChR functional unit of the NMJ end plate membrane was repaired.In order to understand the expression characteristics of muscle cells SNX17 and LRP4,this experiment was performed using WB and Quantitative Real-time PCR(qRT-PCR)techniques at the cellular and animal levels,respectively.ObjectIn this study,a rat model of EAMG were established by artificially synthesizing peptides of 97-116 subunits of rat-derived AchR-?subunits and C2C12 primary cells were established and differentiated.WB and qRT-PCR were used to analyze the expression of SNX17 and LRP4 in different skeletal muscle cells.Methods1.Differentiation and treatment of primary C2C12 cells:Primary C2C12myoblast cells were extracted from SD rat fetuses(1-2 days),and differentiated with2%horse serum,and then divided into blank control group and experimental treatment group.Serum levels of AChR-positive MG patients(AChRAb group)and rabbit anti-mouse LRP4 antibodies(1:1000)(LRP4Ab group)were treated and collected at 0h,0.5h,1h,1.5h,2h,2.5h,respectively.2.Establishment of an EAMG experimental rat model:Active immunization.Twenty healthy female LEWIS rats(6-8 weeks,weight 150-160 g)were randomly divided into two groups,10 in the control group and 10 in the experimental group.The rat model of LEWIS was established by using the murine AchR-?subunit 97-116 peptide as the immunogen-induced model group.The normal control group was given the same dose of adjuvant and PBS.On the 30th day and the45th day of the first immunization,the same doses were immunized at the same site.One week after the third immunization,the evaluation model was started.With Lennon grading score?1,AChRab was positive by ELISA.At the same time,after the low frequency(5Hz)repeated electrical stimulation,the EMG of the gastrocnemius at the 5th time was greater than 10%,which was the successful model for EAMG rat model.3.Real-time fluorescence quantitative PCR detection of muscle cell SNX17,AChR?subtype,LRP4,and MuSK molecules mRNA content:The rats were anesthetized with 5%chloral hydrate and the muscle tissue of each muscle was removed and washed twice with pre-cooled PBS.Each group of muscles was weighed with 40 mg of muscle liquid under nitrogen and one RNA was extracted with Trizol.Invert the RNA into cDNA as described in the Reverse Transcription Kit.The primers of Premier5.0 were designed with primers.SNX17 upstream primers was GACGACGATGTCATGGAGAA and the downstream primers was AGATTTGAGCTGTCGGTGCT,and the amplification product length was117bp.The nChR1 was detected with the AChR?1 subunit,the upstream primer was AGCCTGAACGAGAAGGATGA,thedownstreamprimerwas TGACACGGAGAGACTCGATG,and the amplification product length was119bp.LRP4 upstream Primer sequence was GATGGTTCCTGTCGCAAAGT,and downstream primer sequence was CGTTCAATCTTGGCAATGTG and the amplification product length was 122 bp.MuSK upstream primer sequence was ACCCCAACATTGTGAAGCTC,downstreamprimersequencewas AGTGTGAGGGGACATGCTTC,and the amplification product length was 119 bp.?-actin as an internal reference,its upstream primer sequence was TGTCACCAACTGGGACGATA,downstreamprimersequencewas GGGGTGTTGAAGGTCTCAAA,and the amplified product was 165 bp in length.All primers were synthesized by Shanghai Shenggong.RT-qPCR method was used 20ul reaction system.The fluorescence denaturation reaction condition was95?for 30S;the PCR reaction conditions were:95?for 5 S,55?for 30 S,45cycles.The relative expression level of the target gene was obtained by 2~-??ct??ct method.4.The protein content of SNX17,LRP4 and EEA1 in myocytes was detected by WB method:Remove the above muscle tissue muscles,add RIPA lysate,lysed on ice for 30 min,centrifuged at 12,000 rpm for 5 min,and then remove the supernatant.Cellular protein concentration was measured by BCA method.Then add 5ul per well,GAPDH as internal control,mouse anti-rat SNX17 antibody(1:500),mouse anti-rat LRP4 antibody(1:1000),rabbit anti-rat EEA1(1:1000)and rabbit Anti-rat GAPDH antibody(1:1000)was incubated overnight at 4?,rewarmed at37?for 30 min,incubated with HRP-labeled goat anti-mouse antibody(1:10000)and HRP-conjugated goat anti-rabbit antibody(1:10000)at 37?for 1 h.Exposure,the image analysis software Quantity One was used to determine the average color bands of the target gene and GAPDH,and the expression of each group of proteins was the ratio of the average of the two.Results1.The cellular level:C2C12 myotubes cells were successfully induced to differentiate.Compared with the blank control group,the expression levels of SNX17and LRP4 genes in the AChRAb group were up-regulated,with significant differences(p<0.05),and they increased with time.Expression increased after 1.5hours.There was no significant difference between the two groups(p>0.05).In the LRP4Ab group,the expression of SNX17 gene was decreased,while the expression of LRP4 gene was increased,the difference was statistically significant(p<0.05).2.Animal level:According to the successful modeling standard of EAMG rat model,8 EAMG rats were included in this experiment.Gene detection results showed that the expression of MuSK and nAChR?1 subunit genes in EAMG rat eyes were significantly lower than that in the normal group(p<0.05),while the changes in both masticatory and gastrocnemius muscles were not significant;LRP4 and SNX17 also were not significant in the three muscle groups.WB results showed that LRP4 protein in EAMG rat eye muscles was significantly decreased(p<0.01),while EEA1 protein expression was increased(p<0.05),but the protein expression in gastrocnemius muscle was decreased(P<0.01);SNX17 protein content in gastrocnemius muscle was increased significantly(p<0.01).Conclusion1.Using different MG autoantibody stimuli,SNX17 and LRP4 showed different changes at the cellular level,suggesting that the myocyte response caused by LRP4Ab and AChRAb is not the same,the expression of SNX17 and LRP4 genes in the LRP4Ab group increased,while the AChRAb group SNX17 The content of gene expression decreased and the expression of LRP4 gene increased.2.The changes of the endplate membrane-associated proteins such as SNX17and LRP4 in the ocular muscles,masticatory muscles and gastrocnemius muscle cells induced by ACh RAb at the animal level were different.The expression of LRP4,MusK and nAChR?1 subunits of the ophthalmic muscles were significantly decreased,and the SNX17 protein was in the gastrocnemius muscle.A significant increase in the expression of midbrain can partly explain the reason why AChRAb-mediated myasthenia gravis easily affects the eye muscles.