Effect Of Targeting Silencing VDR On The Migration Ability、Invasiveness And GLi1 Of PC-3 Cells

Objective:To study the expression of vitamin D receptor(VDR)in PC-3 cells(prostate cancer cell line)and significance and the effect of VDR gene on the migration and invasion of PC-3 cells was explored by short hairpin RNA(shRNA)silencing of target genes and to explore the correlation between VDR and glioma-associated oncogene gene1(GLi1).Methods:1.The cells were cultured according to the culture condition of PC-3;the expression of VDR gene and transcription level in PC-3 were detected at the mRNA level by fluorescence quantitative PCR;2.The expression of VDR protein in PC-3 cells was detected at the protein level by cellular immunofluorescence;3.the sangon design and synthesis of plasmid and lentivirus packaging,The VDR-homo-433:5’GGAGTTCATTCTGACAGATGA3’,which has the best interference efficiency against the VDR gene,was selected as the interference sequence;4.PC-3 cells were divided into blank control group,negative control group and experimental group,The vitamin D and vitamin D analogues were not added to the culture fluid.The VDR-shRNA(+)lentiviral vector infecting experimental group was constructed,and the VDR-shRNA(-)lentiviral group was infiltrated in the negative control group.The blank control group was not treated,and mRNA and protein were detected by RT-PCR and Western blotting,respectively.the transcription and expression of VDR were detected in the above three cell groups;5.the migration ability and invasiveness of the three-cell group were detected through the cell scratch healing experiment and Transwell chamber;6.The expression of GLi1 in PC-3 cells was detected by fluorescence quantitative PCR and cell immunofluorescence.The expression of GLi1 protein was detected by Western blotting after Silencing of VDR gene in PC-3 cells.Results:1.Cell culture:PC-3 cells proliferate actively,grow well,and pass or freeze for 4 days;Fluorescent quantitative PCR showed that VDR gene was expressed in PC-3 cells and the transcription level was high;2.The immunofluorescence also showed that VDR protein was expressed in PC-3 cells and the expression level was higher compared with the positive control group;3.RT-PCR results showed that the VDR-shRNA lentivirus carrying the 5’GGAGTTCATTCTGACAGATGA3’ interfering sequence successfully interfered with the VDR gene expression in PC-3 cells.After 72 hours of transfection,the VDR gene transcription level decreased significantly,reaching a rate of 85%;after 96 hours of transfection,the level of VDR gene transcription decreased more significantly,with a decrease rate of 99%.The VDR gene was basically silenced(P<0.05).Western Blot results showed that the VDR protein expression band decreased significantly.After 72h transfected with VDR-shRNA,the decrease rate was 50%;after 96 hours of transfection,VDR protein expression continued to decline and the decrease rate reached 70.3%(P<0.05),the decreasing trend was basically consistent with RT-PCR;4.Effect on cell proliferation and migration:The results of cell scratch test showed that the cell migration was significantly decreased in PC-3 cells after VDR gene silencing,and the healing rate of scratches was lower than that in the blank control group and the negative control group(P<0.05).Transwell chamber experiments showed that the number of transmembrane cells in the VDR interference group was less than that in the blank control group and the negative control group(P<0.05).The invasiveness of PC-3 cells was significantly decreased after VDR silence;5.Fluorescent Quantitative PCR Assays:GLil Gene Transcription in PC-3 Cells.Immunofluorescence analysis showed that GLil protein was expressed in PC-3 cells;Western Blot analysis showed that the expression of GLil protein was significantly decreased after VDR gene silencing in PC-3 cells.The expression of GLi1 protein in PC-3 cells transfected with PC-3 cells with 5’GGAGTTCATTCTGACAGATGA3’ interfering sequence was significantly higher than that in blank control group.the expression of GLi1 protein decrease was 30%after 72h hours of transfection,and the expression of GLi1 protein was still significantly decreased by 60%after 96 hours of transfection(P<0.05).Conclusion:1.VDR gene expressed in PC-3 cells at high expression level to lay the experimental basis for subsequent studies on the correlation between VDR and prostate cancer.2.The shRNA-VDR lentiviral vector carrying the VDR-homo-433:5’GGAGTTC ATTCTGACAGATGA3’ interfering sequence had better interference effect,succ essfully silenced the VDR gene in PC-3 cells and obtained a stable cell line.3.The level of cell migration and invasiveness of VDR gene in prostate cancer cell line PC-3 cells was significantly decreased,indicating that VDR gene is related to the occurrence and development of prostate cancer.VDR can promote the migration and invasion of prostate cancer,VDR exerts this effect on prostate cancer cells independently of vitamin D.4.The GLil gene expressed in PC-3 cells;down-regulation of transcription factor GLil protein expression after VDR silencing can indirectly demonstrate that VDR can promote the Hh-GLi signaling pathway.This study can provide new ideas and cells experimental evidence for the development and prevention of prostate cancer.However,the cell line in this experiment was relatively single,and additional cell lines and animal experiments were needed to verify this conclusion.