Molecular Mechanism Of Splicing Factor PTBP1 Regulating The Alternative Splicing Of AXL On Liver Cancer Invasion And Metastasis

Objective: Liver cancer is one of the main diseases leading to the death of urban and rural residents in China,and liver cancer metastasis is the most important cause of death of liver cancer patients.Further clarifying the molecular mechanism of liver cancer metastasis has a very important guiding role in the treatment of liver cancer.Studies have shown that alternative splicing plays an important role in tumor metastasis.We found that the splicing factor PTBP1 is associated with the ability of hepatoma cells to metastasize,and the high expression of PTBP1 is associated with poor prognosis in patients with liver cancer.Preliminary results indicate that PTBP1 may regulate the selective splicing of AXL and affect the metastasis process of HCC.However,the molecular mechanism of PTBP1 regulating AXL alternative splicing and the effect of PTBP1-AXL alternative splicing signal axis on liver cancer metastasis remain unclear.This study will focus on the molecular mechanism of PTBP1 regulation of AXL alternative splicing,and to elucidate the functional differences between AXL isoforms in the invasion and metastasis of liver cancer.This study can provide new ideas for elucidating the metastasis mechanism of liver cancer cells,and it is of great significance to combat the development of liver cancer metastasis drugs.Methods:1.Transcriptome sequencing,q PCR and Western-blot assays were used to detect the transcription and translation levels of PTBP1 in liver cancer cells with high and low metastatic potential.The TCGA database was used to analyze the difference of PTBP1 expression in liver cancer tissues and normal liver tissues,and the effect of PTBP1 expression level on the survival rate of liver cancer patients;2.The effect of over-expression or knockdown of PTBP1 on the migration and invasion of hepatoma cells was studied by Wound-healing assay and Transwell assay.Subsequently,Western-blot was used to detect the effect of overexpression and knockdown of PTBP1 on EMT marker protein expression;3.RT-PCR and q PCR assay were used to detect the effect of overexpression/knockdown of PTBP1 on the expression level of endogenous AXL-L/AXL-S isoforms in liver cancer cells;pc DNA3.1-AXL-minigene plasmid was constructed in vitro and transfected to the liver cancer cells.Primers for the specific detection of exogenous AXL-L/AXL-S isoforms were designed,and then the effects of PTBP1 on the expression level of exogenous AXL-L/AXL-S isoforms were detected by RT-PCR and q PCR experiments;4.The effects of AXL and AXL-L/AXL-S isoforms on the proliferation,migration and invasion of liver cancer cells were studied by CCK-8,Wound-healing and Transwell experiments;The binding ability of AXL-L,AXL-S isomer to GAS6 ligand,and activation of downstream pathway proteins were studied by immunoprecipitation and Western-blot experiments.5.Predicting the possible binding segments of PTBP1 to AXL pre-m RNA using RBP map and Human Splicing Finder bioinformatics website;Based on the predicted results,the detection primers were designed,and then the sequence segments in which PTBP1 binds to AXL pre-m RNA were verified by CLRIP experiments;In vitro synthesis of biotinylated AXL pre-m RNA fragments that may be bound to PTBP1,followed by RNA pulldown assay to further confirm the binding sequences of PTBP1 to AXL pre-m RNA;Site-directed mutagenesis was performed at the AXL-minigene level,followed by RT-PCR to determine whether PTBP1 also modulates the alternative splicing of AXL Exon10,thereby identifying the binding site of PTBP1 to AXL pre-m RNA;6.p MS2-GFP and pc DNA-AXL-minigene-MS2-12× plasmid were co-transfected into liver cancer cells,and then the nuclear protein of liver cancer cells was extracted for Co-IP experiment.Whether the expression of PTBP1 affects the binding of U2AF2 to AXL minigene is detected by Western-blot assay;7.The effects of PTBP1 and AXL expression levels on proliferation,invasion and metastasis of hepatoma cells were detected by in vitro Transwell assay and subcutaneous tumor and tumor metastasis experiments in vivo.Results:1.Compared with the low metastatic hepatoma cell Hep G2,the transcription and translation levels of PTBP1 in the highly metastatic liver cancer cells HCCLM3 were significantly increased,7.05 folds and 2.47 folds,respectively.The expression level of PTBP1 was positively correlated with the degree of deterioration and poor prognosis of liver cancer patients.The data in the TCGA database showed that the expression level of PTBP1 in clinical liver cancer tissues was 1.65 folds that of normal liver tissues(P<0.05);2.Overexpression of PTBP1 can promote the migration and invasion of hepatocarcinoma cells,and increase the expression levels of Mesenchymal-like proteins Vimentin,N-cadherin,etc.,and reduce the expression level of Epithelial-like protein E-cadherin,thereby promoting the EMT pathway of liver cancer cells;3.In liver cancer cells,AXL is one of the downstream target genes of PTBP1.PTBP1 can inhibit the alternative splicing process of AXL Exon10.Overexpression of PTBP1 can promote the production of endogenous and exogenous AXL-S isoforms;4.AXL-L isoform and AXL-S isoform have different effects on proliferation,migration and invasion of hepatocarcinoma cells.Knockdown of AXL-S isoform can significantly inhibit the proliferation,migration and invasion of liver cancer cells.However,there is no obvious phenomenon(or only weak inhibition)when knocking down the AXL-L isoform;5.The results of CLRIP and RNA-pulldown experiments indicated that PTBP1 binds to two "tctcctctctgtcctttcttct" and "ctgccctcactccctt" polypyrimidine sequences in the intron 9 of upstream of AXL Exon10.Subsequently,the AXL-minigene site-directed mutagenesis(For example,mutating "tctcctctctgtcctttcttct" to "tc Acctc Actgtc Attt Attc A")assays further identified the "tctcctctctgtcctttcttct" polypyrimidine sequence in the intron 9 of AXL as a key polypyrimidine sequence that regulates the alternative splicing of AXL Exon10 by PTBP1;6.MS2-GFP-IP system experiments showed that PTBP1 binds to the adjacent “tctcctctctgtcctttcttct” polypyrimidine sequence of AXL Exon10 and competitively inhibits the binding of U2AF2 to the polypyrimidine sequence.This in turn promotes Skipping of AXL Exon10 to generate AXL-S isoforms;7.In vitro Transwell experiments,in vivo implantable tumors and tumor metastasis experiments showed that PTBP1 promoted the invasion and metastasis of liver cancer cells in part depending on the expression level of AXL-S.Conclusions:1.The expression level of PTBP1 was positively correlated with the degree of liver cancer deterioration and poor prognosis.PTBP1 can promote the migration and invasion of liver cancer cells by promoting the EMT pathway of liver cancer cells;2.In hepatoma cells,AXL is one of the major downstream target genes of PTBP1.In addition,PTBP1 can inhibit the alternative splicing process of AXL Exon10,resulting in increased expression levels of AXL-S isoform in liver cancer cells;3.AXL-L and AXL-S isoforms have functional differences in the process of proliferation,invasion and metastasis of hepatoma cells.Compared with the AXL-L isoform,the AXL-S isoform has a stronger ability to promote invasion and metastasis of hepatoma cells,and has stronger binding ability to the ligand GAS6.Moreover,overexpression of AXL-S promoted the downstream PI3K-AKT and ERK signaling pathways more strongly.4.PTBP1 binds to the adjacent polypyrimidine sequence of AXL Exon10 and competitively inhibits the binding of U2AF2 to the polypyrimidine sequence,thereby promoting skipping of AXL Exon10 to generate an AXL-S isoform;5.PTBP1 promotes the growth,invasion and metastasis process of liver cancer cells in part depending on the expression level of AXL-S.