Font Size: a A A

Regulation And Mechanism Of Cdk5 On Secondary Motor Cortex(M2) Motor Function In Mice Studied By Using CRISPR/cas9 Gene Editing

Posted on:2021-01-14Degree:MasterType:Thesis
Country:ChinaCandidate:X LiFull Text:PDF
GTID:2404330623476905Subject:Pharmacology
Abstract/Summary:
Objective: The central nervous system degenerative disease is an illness whose main pathological feature is the damage and loss of specific neurons in the nervous system.Cyclin-dependent kinase 5(Cdk5)is a serine/threonine kinase involved in synaptic plasticity.In the pathological state of neurodegenerative diseases,Cdk5 transient activation leads to a decrease in synaptic density while increasing beta amyloid(Aβ)production,which causes persistent neurodegenerative lesions in the brain.The secondary motor cortex(M2)plays an important role in neurodegenerative diseases characterized by motor abnormalities.The CRISPR-Cas9 gene editing system can be and edit the genomic DNA of cells in higher organisms,so,in the gene therapy of various human diseases,it has shown a broad application prospect.This project constructs a CRISPR/Cas-Cdk5 genome editing system.Based on the regulation and regulation of the Cdk5 gene in the M2 region,it has taken the lead in conducting preliminary studies on the effectiveness and mechanism of action in normal mice.The regulation of the M2 neural circuit and specific regulation of motor function lay the foundation for subsequent research on the treatment of neurodegenerative diseases.Methods:1.Design of Cdk5-sgRNA lentiviral vector and verification of its expression in vitro and in vivoUsing CRISPR-Cas9 system gene editing strategy,three different pairs of sgRNA sequences were designed and synthesized,and they were loaded into the corresponding expression boxes of the lentiviral vector GV393 to construct the CRISPR-Cas9 system expression vector for the Cdk5 gene.LV/Cas9-sgRNA1,LV/Cas9-sgRNA2 and LV/Cas9-sgRNA3 were tested for expression in vitro and in vivo.(1)The expression verification of HEK293-T cell transfection in vitro was divided into the control group,LV/Cas9-sgRNA1,LV/Cas9-sgRNA2,and LV/Cas9-sgRNA3 transfection groups.After 3 days of transfection,the fluorescence quantitative observation method was used.Each group comes with EGFP fluorescence for fluorescent expression verification observation;(2)Verification of expression of neurons in M2 region in vivo the brain of C57BL/6 mice were randomly divided into control group,LV/Cas9-sgRNA3 M2 region injection group,negative vector M2 region injection group by brain stereotactic injection,and brain stereotactic injection for 21 days Histochemical methods were used for verification.Immunofluorescence staining was used to label the Cdk5 in neurons.Western blot was used to detect the effect of LV/Cas9-sgRNA3 injection on the expression of Cdk5 protein in the M2 region of mice.2.To explore the regulation and action mechanism of M2 neurons after Cdk5 deletion in mice(1)Behavioral activity regulation study,C57BL/6 mice were randomly divided into a control group,a Cdk5-KD group in the M2 region,and a negative vector M2 region injection group.Animal screening was performed 3 days before the injection,and 7,14,21,and 28 days after the injection.Using mouse spontaneous exercise experiments and rotating rod balance experiments,the effects of Cdk5 deletion in M2 neurons on mouse behavior were examined.(2)Quantitative analysis of dendrites and dendritic spines of M2 neurons after Cdk5 deletion using Golgi staining;(3)The electrophysiological technique of brain slices was used to measure the synaptic function of neurons after Cdk5 deletion;GABA receptor antagonist bicuonaria was added to the recording solution to record mEPSCs formed by cell excitatory synaptic conduction,and AMPA and NMDA receptors were added.Antagonists,recording mIPSCs formed by cytostatic synaptic conduction;stimulation of layer V in the M2 region,analysis of fEPSP formed in layer II;(4)The reverse conduction intensity marker of M2 region was injected with fluorescent microspheres(Retrobeads IX)in the Cdk5-deleted region,and the fluorescence quantitative analysis method of frozen section of brain region was performed 3 days after reverse conduction.Results:1.Design of CRISPR-Cas9-mediated Cdk5-sgRNA lentiviral vector and expression verification in vivo and in vitro(1)Designed three CRISPR-Cas9 knockout Cdk5 gene sgRNA sequences: sgRNA1 CAGGCTGGATGATGACGATG,sgRNA2 GTGTGCCAAGTTCAGCCCT C,sgRNA3 TCAGCTTCTTGTCACTATGC;three gene expression vectors were packaged: LV/Cas9-sgRNA1,LV/Cas9-sgRNA2,LV/Cas9-sgRNA3.(2)The designed CRISPR-Cas9 mediated knockout of the sgRNA3 sequence of the Cdk5 gene,and the resulting lentiviral vector showed stronger activity when compared with other groups when verified by transfection of HEK293-T cells in vitro;After 3 μL stereotactic injection,the Cdk5 protein level was reduced by approximately 56.7% compared with the control group(p <0.01).2.To explore the regulation and action mechanism of Cdk5 deletion in M2 neurons on mice(1)The Cdk5-KD group had no difference in exercise performance at 7 and 14 days,and the total distance of exercise and the total number of body rotations were significantly reduced at 21 and 28 days by comparison with the control group(p <0.001);similarly,the Cdk5-KD group showed poor coordination at 21 and 28 days and shortened the fall-latency latency by comparison with the control group(p <0.01).(2)Golgi staining showed that after Cdk5 deletion in the M2 region,the dendrite density of the neurons in the M2 region became sparse compared to other cortical regions,and the dendrite length in the Cdk5-KD group was significantly shorter by comparison with the control group(p <0.001).Spinal densities on dendrites of layer V pyramidal neurons were quantified,and dendritic spine densities per 10 μm in the Cdk5-KD group were significantly reduced compared to the control group(p <0.001).PSD-95 immunofluorescence staining showed that compared with the NC group,the amount of red fluorescence overlapping with EGFP-labeled neurons in the Cdk5-KD group was significantly decreased.(3)The fEPSP results showed that with the increase of the stimulation intensity,the Cdk5-KD group showed a smaller fEPSP slope compared with the control group(p <0.001).Whole-cell recordings showed that the frequency of mEPSC in Cdk5-deleted neurons was reduced by approximately 50%(p <0.001)and the average amplitude of mEPSC was also reduced(p <0.005);and records in mIPSC also showed frequency and amplitude were reduced(p <0.005).(4)The injection of fluorescent retrograde tracer showed that compared with the control group,the intensity of the M2 region of the Cdk5-KD group was significantly lower than that of the ipsilateral prefrontal cortex,screen nucleus and anterior thalamus nucleus(p <0.001)..Conclusion1.New targets for degenerative neurological diseases: Cdk5,CRISPR-Cas9-mediated sgRNA sequence "TCAGCTTCTTGTCACTATGC",which can be accurately and effectively cut the Cdk5 genome in somatic neurons and inhibit the expression of Cdk5.2.The loss of Cdk5 in the M2 region of normal mice can regulate the motor function of mice;the mechanism of this change in motor function is the loss of Cdk5 in neurons in the M2 region,resulting in an overall spine including excitatory and inhibitory synapses reduced density,thereby reducing signal transmission between neurons and between brain regions,has an impact on movement.However,whether the functional role of the CRISPR/Cas-Cdk5 genome editing system in neurodegenerative diseases is yet to be studied.
Keywords/Search Tags:neurodegenerative disease, CRISPR/Cas-Cdk5 gene editing system, secondary motor cortex(M2), motor regulation, signal transduction
Related items