| Objective To explore the relationship between NKX2-5 gene and GATA4 gene exon sequence and single nucleotide polymorphism(SNP)in non-coding region and congenital heart disease(CHD)in high altitude Tibetan.Methods Blood samples(experiment group)from Tibetan patients who were diagnosed with congenital heart disease in The Affiliated Hospital of Qinghai University from 2016 to 2019 and blood samples(control group)from matched healthy Tibetan were collected.In the first part of the experiment,there were 70 samples in the experimental group and 70 samples in the control group.In the second part of the experiment,there were 103 samples in the experimental group and 267 samples in the control group.Primers were designed and sequenced for 2 exons of the NKX2-5 gene and 7 exons of the GATA4 gene in segments;the Sequenom Mass ARRAY ? SNP technology was exploited to type the NKX2-5 gene and GATA4 gene candidate SNP.The experimental data were processed by SPSS19.0 statistical software.χ2 test was used for age comparison between the experimental group and the control group,and t test was used for sex comparison.The representativeness of the sample population is tested by Hardy-Weinberg equilibrium.Genotype,allele frequency,linkage disequilibrium and haplotype analysis among the groups were calculated by webpage http://analysis.bio-x.cn.Odd ratio(OR),95% confidence interval(95%CI)and p values were used to represent the analysis results.Results 1.Exon sequencing results revealed that synonymous substitutions at codon 63(rs2277923)in exon 1 and codon 606(rs3729753)in exon 2 of NKX2-5 gene and non-synonymous substitutions at codon 1129(rs3729856)in exon 6 of GATA4 gene were found in CHD experimental and control groups,and no change in other exon sequences was found.No difference was found in genotype and allele frequencies of NKX2-5 gene rs2277923,as well as GATA4 gene rs3729856.Rs3729753 of NKX2-5 gene did not conform to Hardy-Weinberg equilibrium law and was eliminated in statistical analysis.2.NKX2-5 gene non-coding sequence discovered that rs6882776 and rs2546741 were with significant differences between the experimental and control groups,which the same were found rs117982404 and rs12458 in the non-coding sequences of the GATA4 gene.3.Linkage disequilibrium analysis of 8 SNP of NKX2-5 gene and 20 SNP of GATA4 gene shows that there is strong linkage disequilibrium between each gene locus,forming a haplotype region.The haplotype analysis results showed that the haplotype CAACTCAG(OR = 1.674,95% CI = 1.062-2.638,p = 0.025),CGGCTCAG(OR = 51.860,95% CI = 11.972-224.658,p < 0.001)of NKX2-5 gene and the haplotype CCACGAGCCCGGCTACTCAC(OR = 1.887,95% CI = 1.023-3.481,p = 0.040),CTGCGAGTCCGGCTACTTTC(OR = 19.238,95% CI = 4.848-76.339,p < 0.001)of GATA4 gene were detected to be significantly associated with increase the CHD risk,while the haplotype CAGCTCAG(OR = 0.158,95% CI = 0.070-0.356,p < 0.001),CAGCTCGG(OR = 0.043,95% CI = 0.006-0.306,p < 0.001)of NKX2-5 gene and the haplotype CCACGAGCCCGGCCACCCAC(OR =0.475,95% CI = 0.227-0.992,p = 0.043),CTGCGAGTCCGGCTACTCTC(OR = 0.110,95% CI = 0.017-0.725,p = 0.006),CTGCGAGTCCGGCTACTTAC(OR = 0.162,95% CI = 0.050-0.519,p = 0.001)of GATA4 gene was associated with decreased the risk of CHD.Conclusions 1.The rs2277923 of NKX2-5 gene exon and the rs3729856 of GATA4 gene exon are not related to the susceptibility of Tibetan congenital heart disease.2.There are significant differences in genotype and allele frequencies between the experimental group and the control group at the rs6882776 and rs2546741 of the non-coding sequence of NKX2-5 gene and rs117982404 and rs12458 of the non-coding sequence of GATA4 gene,but whether there is a correlation with CHD remains to be further studied.3.There is strong linkage disequilibrium between SNP sites selected on NKX2-5 gene and GATA4 gene,forming a haplotype region.The haplotypes of NKX2-5 gene and GATA4 gene are related to CHD. |