New Electrochemical Sensing Strategy For In Vivo Analysis In Brain Based On Rational Design Of Specific Probe

Due to the ease of miniaturization,real-time and dynamic detection,electrochemical methods have been widely used in the analytical chemistry for the analysis and detection of biologically active substances.However,in the actual detection in vivo,the concentration of some active substances is low,and the environment in vivo is complicated,and there are other interfering active substances.Therefore,it is still a big obstacle to develop an electrochemical approach for active material analysis with high sensitivity,high stability,high accuracy and high selectivity.Aiming at the problems in the research of in vivo electrochemical analysis,a new method for in vivo electrochemical analysis of important active molecules in vivo is constructed.Designing and synthesizing specific molecular probes,organic ligands and nucleic acid aptamer DNA as the recognition groups,MB as an internal reference,and carbon fiber electrodes as a carrier.Ratiometric electrochemical sensors have been constructed to achieve superoxide anion(O₂^·-)and serotonin(5-HT)in vivo analysis.The details are as follows:Due to the problems of easy inactivation,low selectivity and poor stability of the traditional enzyme-based O₂^·-electrochemical sensors.We designed and synthesized a new organic probe diphenylphosphonic acid-2-naphthol ester(ND)to specifically recognize O₂^·-.At the same time,MB was selected as an internal reference.Single-walled carbon nanotubes(SWCNT)are modified on the surface of the carbon fiber electrode(CFE).And then ND and MB are connected to the CFE/SWCNT electrode through?-?accumulation.First,an anodic peak was generated due to the oxidation of2-naphthol formed by the nucleophilic substitution between ND and O₂^·-.Secondly,the internal reference molecule MB is added to construct a ratiometric sensor to reduce errors caused by differences in internal and external environments.The constructed ratiometric electrochemical sensor has good linearity at 2-200?M of O₂^·-,and the detection limit is as low as 0.52?M.Finally,it was successfully applied to in vivo analysis of O₂^·-in normal and diabetic rats in different brain regions and different ischemic times.The results showed that the O₂^·-concentration in the hippocampus,striatum and cortex increase more rapidly in diabetic rats compared with normal rats with ischemia.It is speculated that diabetic rats may suffer more severe oxidative damage under cerebral ischemia.In response to the similar structure of monoamine neurotransmitters,and the poor selectivity of 5-HT analysis in organisms.We constructed an electrochemical sensor based on nucleic acid aptamers.Nucleic acid aptamer DNA(5'CTCTCGGGACGACTGGTAGGCAGATAGGGGAAGCTGTTCGATGCGTGGG TCGTCCC3')is the recognition unit of 5-HT,and the ferrocene(Fc)on its 5'end provides electrochemical signals.DNA-Fc(-C?C-DNA(5-HT)-Fc)and internal reference molecule MB(-C?C-DNA(MB)-MB;DNA(MB),5'GGCGCGATTTT3')through the alkynyl(3'end)group was co-assembled on the surface of the gold-plated microelectrode,and the ratiometric electrochemical sensor was successfully constructed.After Fc-DNA(5-HT)was combined with 5-HT,single-stranded structure of the DNA was folded,and the Fc gradually approached the surface of the electrode to increase the electrochemical signal,thereby achieving high selectivity electrochemical analysis of 5-HT.Moreover,we optimized the sensor,adding the rigid molecule 4-thiophen-3-ethynylbenzaldehyde(TB)as a modified substrate.Aptamer DNA(NH₂-DNA_(5-HT)-Fc)and MB(NH₂-DNA_(MB)-Fc)were connected to rigid molecules through schiff reaction,which enhances the electrode reproducibility and detection sensitivity.It exhibits good linearity in the range of 0.1-100?M of 5-HT,and the detection limit is as low as 0.026?M.Finally,it was successfully applied in measurement and analysis of 5-HT in different brain regions(striatum,hippocampus and cortex)under sleep deprivation.The results showed that the 5-HT concentration in different brain regions showed a downward trend with the increase of sleep deprivation time.Among them,the hippocampus was the most obvious.After 3 days of sleep deprivation,the 5-HT concentration decreased by 50%.