Functional Characteristics Of G-quadruplex In Porcine Reproductive And Respiratory Syndrome Virus Proliferation

G-quadruplexes(G4)are four-stranded conformations formed by guanine(G)-rich nucleic acids,widely distributed in the eukaryotic genome that play key roles in DNA replication,telomere maintenance,gene expression and regulation,and genetic instability.As a non-classical nucleic acid structure,the G4 structure also exists in viral genomes.Recently,an increasing number of researches associated with G4 structure in viruses have shown the great importance of G4 in regulating viral protein synthesis and viral proliferation.PRRSV is a single-stranded,positive-sense RNA virus with genome length of about 15 kb.The synthesis of PRRSV genomic RNA and sub-genomic RNAs requires the negative-strand RNA as a template.Sequence analysis identified two highly conserved putative G4-forming sequences in the negative-strand RNA of PRRSV.In this project,a series of biochemical experiments were used to analyze the formation and function of G4 during PRRSV replication,and the complex mechanism of PRRSV replication and proliferation will also be evaluated.Taken together,this project may not only provide a deeper understanding of the viral RNA replication mechanism,but pave the way to the development of anti-PRRSV drugs and effective vaccine.The specific work content is as follows:1.Identification and conservation analysis of putative G-quadruplex sequences(PQS)in PRRSV negative strand RNAThrough systematic bioinformatics analysis and QGRS Mapper analysis,performed across the whole PRRSV genome and the negative strand RNA,two overlapped putative G-quadruplex sequences(PQS)were identified in PRRSV(-)RNA.Such two G-rich sequences,named as G4-1(GGGCCGGUACGGGAGGGGGCAGGG)and G4-2(GGGUGGGGGUGCGGGGGUUGGG),fulfilled the criteria G?3N_1-7G?3N_1-7G?3N_1-7G?3and showed great potential to form G4 structures.We next applied multiple sequence alignments and revealed that the two identified PQS were highly conserved among different PRRSV strains.2.Structure validation of G4-1 and G4-2 in PRRSV(-)RNATo assess the ability of the two identified PQS G4-1 and G4-2 derived from PRRSV(-)RNA to form G-quadruplex structures,native PAGE was performed.There are bands corresponding to target RNA G4-1 and G4-2 migrating significantly faster as compared to their mutant counterparts,suggesting the formation of compact G4 structures.Circular dichroism(CD)spectra analysis showed that both the two PQS G4-1 and G4-2 displayed characteristic?260 nm peak and?240 nm tough,indicative of adopting a parallel topology.3.Repression of enhanced green fluorescent protein expression through PRRSV G4RNA stabilizationTo further investigate the potential biological function of the verified G-quadruplex structures formed in PRRSV negative-strand RNA,we conducted a series of p EGFP-C1derivatives by fusing either the target PRRSV G-rich sequences or the mutant sequences into the N terminus of the EGFP-cds.Then a confocal fluorescence assay was performed to assess the effect of PDS on EGFP expression.G-quadruplex stabilizing compound PDS treatment led to significant inhibition of EGFP expression in p EGFP-G4-1 or p EGFP-G4-2 compared with untreated control,whereas such effect on EGFP expression in p EGFP-G4-1 mut or p EGFP-G4-2 mut was much-alleviated under the same circumstances.Taken together,G4 ligand PDS,specifically targeting G4 structures in PRRSV(-)RNA,may impair EGFP reporter gene expression.4.G-quadruplex stabilizers PDS and BRACO-19 significantly diminished PRRSV replicationFor the G-rich sequences in PRRSV negative-strand RNA were verified to form G4structures,we next evaluated the effect of such G4 structures on PRRSV replication.PDS and BRACO-19,two G-quadruplex stabilizers,were reported to bind and stabilized G4structures.Our results provide direct evidences that PDS and BRACO-19,specifically targeting and stabilizing G4 RNA within the negative strand of PRRSV,effectively diminish PRRSV viral replication.5.Unwinding G4 structures within the negative strand of PRRSV effectively promoted PRRSV replicationSince the G4 structures formed in PRRSV(-)RNA was harmful to virus proliferation,unwinding this structure was necessary for the normal replication of PRRSV genome.Streptavidin pull-down assays were performed to identify the RNA G4 helicase proteins.The results showed that PRRSV collaboratively exerted the viral helicase nsp10and host helicase protein DDX18 to unwind the G4 structures within the negative strand of PRRSV,effectively promoting PRRSV viral proliferation.