Expression Analysis And Active Cyclic Peptides Design Of Ligusticum Chuanxiong α-amylase Inhibitor

α-amylase inhibitor（ASI）is an active peptide with a Kunitz domain,consist of 180-200amino acid residues and 2 disulfide bonds.ASI can inhibit the activity ofα-amylase by forming target enzyme-inhibitor complex withα-amylase.ASI not only inhibitsα-amylase in a variety of insects,affects the absorption of nutrients by insects,acting as an anti-insect role,but also inhibits the activity ofα-amylase in the human intestine and reduces the digestion and absorption of sugar in the human body resulting in lowering blood sugar and blood fat.At present,ASI has been widely used in the fields includes weight loss,diabetes treatment and pest control.Our laboratory successfully amplified the full-length c DNA sequence of the Ligusticum chuanxiongα-amylase inhibitor gene（LASI）in the early stage,and it has been verified that LASI can inhibit the activity ofα-amylase.In this paper,we mainly focus on the expression ofα-amylase inhibitor（LASI）in Ligusticum chuanxiong Hort and the design the active cyclic peptide;the LASI prokaryotic expression vector was constructed to find out its optimal prokaryotic expression conditions;transgenic plants with LASI gene was obtained to verify the function of LASI gene in Arabidopsis thaliana;the Co TI-LASI fusion protein was obtained by constructing the Co TI-LASI fusion expression vector;and the active cyclic peptide was designed and synthesized according to the docking simulation experiment of LASI.This study lay a theoretical foundation for LASI’s large-scale fermentation production,treatment of diabetes,insect resistance and related transgenic plant cultivation.The main findings are as follows:（1）Through the overall analysis of the codon preference of 13 ASI genes of different species,it found that the average ENc of ASI gene is 51.143,and the overall ASI preference of plants is low.The CG3 value of ASI is 0.327-0.648,which means that the usage of synonymous codons is relatively uniform,and it also means that most of the codons of ASI gene are A/U.The CAI value is 0.636-0.720,and the CAI value is low,which indicates that the expression level of ASI gene is low.The results of ENc-plot show that the overall differences between the actual ENc value of the ASI gene and the expected ENc value is small,and the codon preference is more affected by mutations and relative weakly affected by selection.ENc value of Morus notabilis Schneid is the closest to the standard curve,indicating that its bias is basically not affected by selection.Some individual points are deviated from the curve,such as Hevea brasiliensis,Glycine max,and Vitis vinifera L,indicates that its codon preference is deeply affected by selection.Through comparing with model organisms,it found that there are only 12 codons in the LASI gene and the A.thaliana genome with greater bias,and there are 20 codons with greater bias in the Drosophila group,24 codons with greater bias in Escherichia coli,16 with greater bias from yeast,and 16 with greater bias from Medicago Sativa,indicating that A.thaliana expression system is superior to the other four expression systems and thus have laid a theoretical foundation for genetic evolution research and functional verification of LASI genes（2）In order to better carry out researches on LASI gene functional identification,structural biology and transgenic plant cultivation,it is necessary to improve the expression efficiency of LASI in the host.In this study,by comparing the expression effects of four prokaryotic expression vectors,it finally determined that the p ET28a-LASI recombinant vector can partial soluble expressed the recombinant LASI protein at IPTG concentration of 1.0 m M and induced overnight at 27℃.The recombinant protein was purified by Ni²⁺affinity column and verified by Western-Blot.A single band was displayed at the target position,indicating that the protein obtained by induced expression and purification was LASI.Activity test results showed that the final inhibitory ratio of Ligusticum chuanxiongα-amylase inhibitor（LASI）toα-amylase is 34%.Compared with other same type of amylase inhibitors,LASI inhibitory activity onα-amylase needs to be further improved.（3）Transgenic plant technology can introduce exogenous genes into specific plants,thereby improving resistance to harsh growth environments such as low temperature,saline-alkali,droughts and floods.Based on the full-length sequence of the Ligusticum chuanxiongα-amylase inhibitor（LASI）gene cloned in the laboratory,the expression vector p Cambia2301-LASI in A.thaliana plants was constructed.The LASI gene was transformed into the model plant A.thaliana by agrobacterium-mediated method.The test results showed that the LASI gene was successfully transferred into A.thaliana.The obtained transgenic A.thaliana with LASI can provide experimental materials for further study on the function of LASI and controlling insect resistance in A.thaliana.（4）Co TI（Cassia obtusifolia Kunitz trypsin inhibitor）and LASI are protein inhibitors in plants,inhibits the activities of trypsin and amylase,respectively.Our laboratory has conducted preliminary research on Co TI and LASI in the early stage,but the expression effect of LASI is not optimistic.Therefore,by constructing Co TI-LASI fusion protein,we aim to obtain sufficient Co TI-LASI fusion protein by utilizing the synergistic effect of these two proteins.Use the Co TI and LASI recombinant plasmids stored in the laboratory as a template,design primers according to the primer design principles,Linker sequence between the two genes was designed as GGCGGAGGTGGCTCTGGCGGTGGCGGATCGGGTGGTGGTGG TTCT.After PCR amplification,restriction enzyme digestion and ligation,the p ET28a-Co TI-LASI prokaryotic expression vector was successfully constructed,and the expression conditions of the Co TI-LASI recombinant protein were optimized.The foundation for the fusion gene research and the improvement of plant multiple resistance was laid.（5）Natural LASI has the characteristics of high immunogenicity,slow absorption and slow metabolism,which is easy to form complex with phytic acid,cellulose and other components in food.In order to synthesize a cyclic peptide with a small molecular weight andα-amylase inhibitory activity,this study analyzed the structural characteristics of LASI.The homology modeling technology successfully obtained the three-dimensional structure of LASI,and the structure was used in docking and simulation experiments with 1BVN（α-amylase crystal structure）.The analysis results showed that there is an interaction between LASI and1BVN.In LASI,Asn86,Phe85,Gly87,Leu95,Val88,Ser94,Thr89,Gln93,Ile92,Cys91,Ile90 form a"ring"tightly surrounding 1BVN,among which Thr89 and 1BVN Leu3,Lys315,Gly5,Phe279 all produce hydrogen bonds.It is inferred that it is an important site for the binding of LASI and 1BVN.Therefore,this study used Thr89 as the center to synthesize cyclic peptides,and tested the inhibitory activities of cyclic peptides with cotton bollworm,Spodoptera litura and porcine pancreatic amylase.The experimental results showed that when30μg cyclic peptide I was added,the residual activities of cotton bollworm,Spodoptera litura and porcine pancreatic amylase were 52%,48%and 36%.When 30μg cyclic peptide II was added,the residual activities of cotton bollworm,Spodoptera litura and porcine pancreatic amylase were 49%,45%and 39%respectively.Compared the inhibitory activity of LASI and cyclic peptide on porcine amylase at the same concentration,it found that the inhibitory activity of cyclic peptide on porcine amylase is weaker.We speculate that there are other sites of action in LASI besides Thr89,which needs to be further studied.The results of this research can provide certain references for the subsequent applications of cyclic peptides in food and medicine.