Font Size: a A A

Identification Of Plant Viruses From Maize By Deep Seauengcing And Establishment Of RT-LAMP Ampification For The Rapid Detection Of Maize Vellow Mosaic Virus

Posted on:2018-03-01Degree:MasterType:Thesis
Country:ChinaCandidate:S QianFull Text:PDF
GTID:2493305165982359Subject:Bio-engineering
Abstract/Summary:PDF Full Text Request
Maize virus disease is one of the major diseases that reduce maize production,It’s very important to test and identify maize virus fast and accurate,However,the traditional plant virus identification technology has some limitations.Using small RNA deep sequencing technology in detection of virus species has obvious advantages,is the most important method of identification of plant viruses.In this study,maize samples was collected from Yongsheng(YS4-1),Wuding(WD1-2,WD3 1)and Yuanmou(YM3-1)county,Yunnan Province which showed Chlorotic mottled,mosaic,yellowish and necrotic.The maize virus in each sample was identified by small RNA sequencing.Get the following results:(1)By using the small RNA deep sequencing technology,the total RNA extraction,library construction,library quality control,with HiSeq TM 2500 for sequencing,with bowtie,velvet software analysis were obtained 62,126,93,68 contigs.Sugarcane mosaic virus(SCMV)and Maize-associated totivirus 1(MATV1)were detected in the sample YS4-1.Maize yellow mosaic virus(MaYMV)was detected in the samples WD1-2 and WD3-1,Sample YM3-1 contains Sugarcane mosaic virus(SCMV)and Maize chlorotic mottle virus(MCMV).(2)The Loop-mediated isothermal amplification(LAMP)technique detected primer was(F3:TGGTGGTTACGCTTCATGTG;B3:TCCCAACCTGGAGGTCCTTG;FIP+F2(Flc):TTCTCCTTTCTGGGCCGTTTTGCT TGCTTAATGGTAGCAAT;BJP(B1+B2c):CAGGACTGGTAACAAGATCATTT TCTCACGTCGGAATTCGTGGT).The results showed that when the reaction temperature was 65℃,and the reaction time was 60 min,that method can quickly and accurately detect MaYMV.MaYMV was quickly detected in sample WD-1 and WD3-1 by LAMP.
Keywords/Search Tags:Small RNA deep sequencing, Identification of virus, Bioinformatics, LAMP
PDF Full Text Request
Related items