Font Size: a A A

Silencing Of Key Genes In Congenital Heart Disease By RNAi And CRISPR/Cas9

Posted on:2022-06-06Degree:MasterType:Thesis
Country:ChinaCandidate:F ZhangFull Text:PDF
GTID:2504306506479914Subject:Surgery (Cardiothoracic Surgery)
Abstract/Summary:PDF Full Text Request
Objectives:This study was to construct and identify transcription factor GATA4 and NKX2-5 lentivirus vectors by RNAi silencing technique.The aim was to study the expression pattern of pathogenic genes GATA4 and NKX2-5 in congenital heart disease in vitro.The expression vectors of GATA4,TBX5 and NKX2-5,the key genes of congenital heart disease were constructed using CRISPR/Cas9 technology.The research results laid a preliminary molecular experimental basis for the subsequent gene editing work.Methods: 1)RNA interference.The lenti CRISPRv2 vector was digested by Bsm BI(Esp3I)restriction enzyme,and linearized vector was obtained by gel recovery.T4 ligase was used to link the treated double-stranded sg RNA to the vector.Two viral expression vectors(lenti CRISPRv2-NKX2-5、lenti CRISPRv2-GATA4)were obtained by Escherichia coli transformation,colony PCR identification,plasmid extraction and sequencing.Two siRNA interference sequences of NKX2-5 and GATA4 genes were designed to connect with p MGic7.1 vector after restriction enzyme Bsm BI.After the successful construction of the vector,lentiviral vector containing the interference sequence of NKX2-5 siRNAs was transfected into HUVEC cells,and lentiviral vector containing GATA4 siRNAs was transfected into 293 T cells.NKX2-5 gene was random Ly divided into experimental group and negative control group.GATA4 gene was random Ly divided into experimental group,negative control group and blank control group.The protein expressions of NKX2-5 and GATA4 were detected by Western bloting,and the gene expressions of NKX2-5 and GATA4 were detected by q RT-PCR to determine the silencing levels of GATA4 and NKX2-5 genes.2)CRISPR/Cas9 technology.The key genes NKX2-5,GATA4 and TBX5 of congenital heart disease were searched by NCBI database,and the corresponding sg RNA of three genes was designed online by biosoftware.The chronic virus vector lenti CRISPRv2 was digested by Bsm B I single enzyme,and the linearized vector was obtained by gel recovery.T4 ligase was used to connect the treated double-stranded sg RNA with the vector.Three viral expression vectors,lenti CRISPRv2-NKX2-5,lenti CRISPRv2-GATA4 and lenti CRISPRv2-TBX5,were finally obtained by E.coli transformation,Plasmid Extraction and sequencing.Results:1)The siRNA interference sequence of gene NKX2-5 was CCGGG CCTCAATCCCTACGGTTATACTCGAGTATAACCGTAGGGATTGAGGCTTTTT TG.The percentage of positive cells reached the peak at 5μg/m L of Polybrene,and the transfection efficiency was more than 80%.Western blot results showed that the PLVE264 protein level in the experimental group was lower than that of the control group PLVT7.qPCR results showed that the expression of PLVE2641 target gene NKX2-5 was significantly decreased in the experimental group,and the inhibition rate was over 72%(P<0.05),indicating that NKX2-5 gene was effectively silenced.The GATA4 pMGic7.1 vector was correctly connected with one siRNA interference sequence the gene sequence was CGAAACACCGGGGACATAATCACTGCGTAATCCTCGAGGATTACGCAGTGATTATGTCCTTTTTTGAATTCGGA.In the blank control group,there was a protein band at 45 kDa.The relative expression of GATA4 protein in the experimental group was 0.739±0.056,the negative control group was 0.997±0.001,the comparison between the two groups was P<0.05.The relative expression of GATA4 mRNA in the experimental group was 0.362±0.024,the negative control group was 0.998±0.001,and the blank control group was 0.812±0.001.The relative expression of GATA4 was significantly lower than that of the negative control group and the blank control group(all P<0.05).2)The sgRNA with the highest score and the right number of bases was obtained,through linear enzymatic digestion of the expression vector,the displaced fragments of about 2000 bp in thevector were successfully removed.Sequencing of the linked vectors showed that the sequence of double-stranded sg RNA was identical with that of the replacement fragment of the viral expression vector.Conclusion The expression vectors of NKX2-5,GATA4 and TBX5 were successfully constructed using Crispr/Cas9.Conclusions: The RNAi lentiviral vectors of NKX2-5 and GATA4 genes were successfully constructed and transfected into HUVEC and 293 T cells,respectively.The expression of NKX2-5 and GATA4 genes were effectively suppressed in transfected cells.These results laid an experimental foundation for further study of CHD formation.The expression vectors of NKX2-5,GATA4 and TBX5,the key genes in congenital heart disease were successfully constructed by CRISPR/Cas9.The result provided a theoretical basis for gene therapy.
Keywords/Search Tags:congenital heart disease, transcription factor, RNA interference, CRISPR/Cas9
PDF Full Text Request
Related items