| Objective:Trigeminal neuralgia(TN)is a clinically common refractory pain syndrome,and the etiologies and pathologies are unclear.It is reported that 5-Hydroxytryptamine2A receptor(5-HT2AR)has a pain-regulating effect in the central nervous system.The role of 5-HT2AR in the trigeminal neuralgia and how 5-HT2AR-mediated synaptic transmission in the ventrolateral(VLO)orbital cortex influences pain are explored.Method:1.Different 5-HT2AR shRNA interference sequences were designed and packaged into plasmids which were then transfected into HEK293-T cells to screen the most powerful sequence via RT-PCR technology.The 5-HT2AR shRNA sequence with the best interference efficiency was packaged into an adenoviral vector(AAV)and was then stereotaxically injected into the mouse ventrolateral orbital cortex(VLO)to verified the efficacy of interference in vivo through Western blot technology.2.5-HT2AR-knockdown model(5-HT2AR-KD)was established through injection of screened AAV into VLO of mice and the locomotor activity was measured.The orofacial formalin test and chronic constriction of the infraorbital nerve were used to establish trigeminal neuralgia models to determine the influence of decreased 5-HT2AR in VLO on the orofacial pain of mice.3.Whole-cell patch clamp technique was used to record the changes of frequency and amplitude of spontaneous excitatory postsynaptic currents(sEPSCs)in VLO of mice.Result:1.RT-PCR results showed that the plasmid with“GCTCAATTCCAAACTCCTTAA"sequence has better interference efficiency than other plasmids.Western blot results verified the significantly reduced expression level of 5-HT2AR protein in the VLO brain area compared with the control mice.2.No significant difference in locomotor activities was observed between the 5-HT2aR-KD group and control group.3.The orofacial formalin pain experiment showed that there was no statistical difference in the total time of rubbing the whisker pad between 5-HT2AR-KD group and control group during the early phase of pain,whereas the total time of rubbing behavior was significantly longer in the 5-HT2AR-KD group than that in the control group during the late phase of pain.4.The infraorbital nerve ligation experiment showed that,compared with the sham group,the mice in the infraorbital nerve ligation(IoN-CCI)group had obviously spontaneous pain and mechanical allodynia after operation,and the pain could last for at least 21 days.Compared with the control group,5-HT2AR-KD group had a lower response threshold to the same intensity of mechanical stimulus.After intraperitoneal administration of 2,5-Dimethoxy-4-iodoamphetamine(DOI),a 5-HT2AR agonist,the mechanical threshold of the two groups was significantly increased(0.43 ± 0.06g in the control group,0.25 ± 0.03g in the 5-HT2AR-KD group).Compared with the control group,the time of rubbing behavior in the 5-HT2AR-KD group significantly increased after surgery and then decreased due to the intervention of DOI.5.The whole-cell recording mode was used to record the synaptic activities of VLO neurons.Compared with the control group,the frequency and amplitude of sEPSCs of VLO neurons significantly decreased in the 5-HT2AR-KD group.Conclusion:1.The decrease of 5-HT2AR expression in VLO brain area increases the orofacial pain in trigeminal neuralgia model of mice.Whereas,the intervention of DOI decreases the orofacial pain in trigeminal neuralgia model of mice.2.The decrease of 5-HT2AR expression in VLO brain area reduces the amplitude and frequency of sEPSCs of VLO neurons in mice,which affects synaptic plasticity.This may be one of the mechanisms of 5-HT2AR in the VLO involved in orofacial pain. |