Two Short Repeats In The 5’ Untranslated Region Of Insulin-Like Androgenic Gland Factor In Procambarus Clarkii(PcIAG) That Regulates PcIAG Expression

There are growth differences between males and females of Procambarus clarkii.Sex regulation and monosex culture have been attractive research areas in their culture.The key to the realization of monosex culture technology is to understand the mechanism of sex differentiation and regulation of crayfish,to elucidate the functions and regulatory mechanisms of the relevant genes.Insulin-like androgenic gland hormone(IAG)is an important gene that regulates sex differentiation in decapods.In this study,we found that there were two repeats in the 5’ untranslated region(5’UTR)of P.clarkii IAG gene(PcIAG)that might be involved in the regulation of PcIAG expression.To explore the role of the two repeats in the regulation of PcIAG expression,the promoter and gene structure of PcIAG,m RNA,and miRNA expression profiles after interfering with two siRNAs(GsiRNA and YsiRNA)that synthesized according to the two short repeats in 5’UTR of PcIAG were analyzed.MiRNA sequencing and proteome sequencing was performed on exosomes in blood before and after androgenic gland ablation of P.clarkii could help understand the relevant regulatory factors that may be involved in the expression of PcIAG.The results of the study are expected to provide transcriptional level reference materials for the study of the molecular regulatory mechanism of PcIAG in crayfish,and enrich the studies related to sex regulation and monosex culture in crayfish.The main study contents and results are as follows:(1)Analysis of the DNA sequence,promoter sequence and the location of repeated sequences region of the IAG gene of Procambarus clarkiiThe full-length DNA sequences of PcIAG consisted of four exons and three introns,with a total length of 20,964 bp.The length of the promoter was 1363 bp,the repeat sequence region containing two short repeats(TCACCATCTGTGACTCTCCTCCCTCC and TCACCATCTGTGACTCTCCTCCCTCA)was located between the transcription start site and the initiation codon,which indicated that the repeated sequences were located in the 5’UTR.(2)The existence pattern of repeats in different tissues and developmental stages of female and male Procambarus clarkiiThere were no differences in the repeat sequences between males and females at the DNA level.The IAG c DNA sequence from AG tissue contained the region of the repeated sequence,whereas other tissues(such as eyestalk,brain and hepatopancreas)did not.There were no products amplified in the c DNA sample of different developmental stages of P.clarkii within four months before becoming adult male P.clarkii.(3)Examination of the effectiveness of repeat sequences-based synthesis of siRNAs to interfere with the IAG gene of crayfishThe siRNAs synthesized based on the repeats were used to interfere with PcIAG.The results showed that the expression level of PcIAG was significantly downregulated in the GsiRNA and YsiRNA groups compared with the control group in androgenic gland(AG),indicating that the expression of PcIAG could be effectively inhibited by GsiRNA and YsiRNA.In other tissues,GsiRNA and YsiRNA have a poor inhibitory effect or even fail to inhibit the expression of PcIAG.WsiRNA(based on non-target gene design)could not inhibit the expression of PcIAG in the five tissues.The difference in inhibitory effect might be related to the presence of repeated fragments only in AG tissue.(4)Analysis of m RNA expression profiles of gonads and nerves after interference with IAG gene in crayfish based on repeat sequences synthesis of siRNAsAfter interference with siRNA,sex-related genes such as Vg,Dmrt,Wnt4 and Sxl were found to be differentially expressed.Enrichment analysis showed that the differentially expressed genes were enriched in sex-related pathways such as Wnt signaling pathway,Oocyte meiosis,Gn RH signaling pathway and Estrogen signaling pathway,indicating the importance of IAG in sex regulation.In gonadal tissues,differentially expressed genes of the GsiRNA group vs.control group and YsiRNA group vs.control group were enriched in many sex-related GO terms.However,the sex-related GO terms were not enriched in the differentially expressed genes in the WsiRNA group vs.the control group.The enrichment analysis results indicated that the region of the repeated sequence in the 5’UTR region of PcIAG maybe has an effect on sex regulation.Differences in GO enrichment results for differentially expressed genes between GsiRNA group vs.control group and YsiRNA group vs.control group,such could indicate that the regulation of expression of PcIAG with GsiRNA and YsiRNA was different although there is only one base difference between the two repeats.And the analysis revealed that this difference in regulation seems to be related to the Wnt signaling pathway.(5)Analysis of miRNA expression profiles in the gonads of crayfish IAG gene after interference with siRNAs based on repeat sequences synthesisThe GO enrichment results of the target genes of differentially expressed miRNAs were similar to the above differentially expressed genes.Target genes of differentially expressed miRNAs in the WsiRNA group vs.control group were not enriched to the sexrelated GO terms.However,there were also differences in the sex-related GO terms of the target genes of differentially expressed miRNAs between the GsiRNA group vs.control group and YsiRNA group vs.control group.It could be further confirmed that the small RNA interference pathway for regulation of PcIAG was different although there is only one base difference between the two siRNAs(GsiRNA and YsiRNA).In addition,mi R-1 and mi R-100 were highly expressed in gonadal tissues,and sex-related miRNA such as bantam-3p,mi R-34,mi R-133,mi R-263 a and mi R-263 b were identified to be differentially expressed.(6)Analysis of miRNA in exosomes before and after androgenic gland ablationComparison of the top 10 highly expressed miRNAs after siRNA interference with miRNAs in exosomes.The mi R-1 and mi R-100 were highly expressed in exosomes before and after androgenic gland ablation.The let-7 one of the top 10 miRNA expressed in Te and AG tissues after siRNA interference,and the expression of let-7 was increased after androgenic gland ablation.Such results suggested that let-7,mi R-1 and mi R-100 might play an important role in the sex regulation of P.clarkii.A total of eight miRNA,including animal-mir-143-3;animal-mir-133-3;animal-mir-143-1;animal-mir-34-5;animal-mir-181-11;animal-mir-224-1;animal-mir-193-5;animalmir-25-8,were differentially expressed in exosomes.Among the eight differentially expressed miRNAs,the three differentially expressed miRNAs mi R-34,mi R-133 and mi R-193 were also found in miRNA expression profiles after interfering with siRNA.Moreover,mi R-133 can be enriched to target genes related to the Wnt signaling pathway,such as Wnt-5b,indicating that the difference in the regulation of PcIAG by the two re-peats may be related to mi R-133.(7)Analysis of proteins in exosomes before and after androgenic gland ablationA total of 98 differentially expressed proteins were identified in exosomes before and after androgenic gland ablation.Among which two differentially expressed proteins,14-3-3 zeta and Cell division cycle protein 27 homolog,may be involved in sex regulation in P.clarkii.