| Background:Post-traumatic stress disorder(PTSD)is a kind of long-term mental illness induced by acute and traumatic events.PTSD has a series of symptoms,such as fear and anxiety,depression,dysfunction of cognitive and social behaviors and suicide.All the symptoms normally delayed and persist for a long time.Research suggests that the lifetime prevalence of PTSD ranges from 1.3%to 12.2%.However,the pathogenesis of PTSD is complex and diverse and has not yet been elucidated.There are genetic factors,stress experience in early life,Hypothalamic-pituitary-adrenal(HPA)axis dysfunction,and neuroendocrine factors.Among them,early life stress experience increased the risk of PTSD.Therefore,the research to understand the pathogenesis of PTSD is of great significance for prevention and treatment.Stress in early life refers to the response of an individual to a variety of negative physical and psychological events early in life,such as early childhood or adolescence.Adolescence is a critical period of growth and development of brain.Adversity stressful stimulus during this stage has a lasting impact on emotional and cognition-related brain regions,resulting in disorders of learning and memory function,emotional regulation and social behaviors.However,the specific mechanism is not very clear.Brain derived neurotrophic factor(BDNF)is considered to have a vital function in neuronal development,growth and differentiation.Moreover,the biological effects of BDNF are extensively,such as inhibiting the death of damage neurons,improving pathological state of neurons and motivating regeneration of neurons.Studies have demonstrated that BDNF is a main link in the pathogenesis of depression and PTSD.Recently,the role of epigenetic mechanisms in the susceptibility of PTSD caused by environmental factors such as stress has received attention.Studies have shown that maternal separation,social isolation and chronic unpredictable stress cause irreversible changes in the epigenetic factor H3K9me2/3,and H3K9me2/3 has a negative regulatory effect on Bdnf gene expression.Results indicated stress induced epigenetic changes are the key molecular biological mechanisms of animal behavior abnormalities.However,it is unclear whether traumatic stress in adolescence lead to changes of epigenetic mark and by what mechanisms of these changes lead to persistent behavioral abnormalities.The present study used the post-traumatic stress disorder animal model to investigate the short-term(adolescence,21-day-old)and long-term(adulthood,63-day-old)effects of traumatic stress on the epigenetic modification markers H3K9me2 and H3K9me2/BDNF levels.To clarify the level of epigenetic modification marker H3K9me2 after traumatic stress in adolescence and whether it is involved in regulating the expression of Bdnf gene,thereby affecting the expression level of BDNF mRNA and protein and the development of neuronal dendrites.Objective:(1)To prove the short-term and long-term effects of traumatic stress on depression-like behavior,social exploration and cognitive function in adolescence and adult rats.(2)To prove the short-term and long-term effects of traumatic stress on neuron dendrite development in the brain region of hippocampus(HIP),prefrontal cortex(PFC)and amygdala(AMG)of rats.Materials and Method:(1)Experimental Design72 male Wistar rats,based on body weights,were grouped into three groups(24/each group)randomly after 7 days of adaptive feeding.Our experiment are totally 6 groups(12/each group),the adolescent control group(AdoC),the adolescent PTSD group(AdoP),the adolescent medication group(AdoP+U),and the adult control group(AduC),adult PTSD group(AduP),adult medication group(AdoP+U).(2)The inescapable foot electric shock procedure(3)Drug treatmentUnc0642,a small molecule inhibitor of histone methyltransferase(EHMT2),was dissolved in DMSO,Peg300 and DDW.Intraperitoneal injection(2.5 mg/kg/d)of drug was given within half an hour at the end of the daily shock.(4)Behavioral testsThe exploration in new environment,anxiety-like behavior,the ability to explore novelty environment and strange rats and he spatial exploration and spatial memory capabilities were evaluated by the open field test(OFT),the elevated plus maze test(EPT),the social interaction test(SIT),and the Morris water maze(MWM)test.(5)Golgi stainingAfter sacrifice of the rats,three whole brains are placed in 4%paraformaldehyde tissue fixative for more than 24 h.Brain tissue is gently rinsed with normal saline and is completely submerged in a specimen bottle(followed by Golgi dye in the specimen bottle).Putting them in a dark,cool and ventilated place for 14 days.After staining,dehydrating and photographing,using Image J 6.0 software to analysis.In the 200× field of view,the total number of intersection is calculated,that indicated the length and branches of dendrites.The method is to take the cell body of the neuron as the center of the circle,do the concentric circles with a radius difference of 10 um,count the sum of the intersection of the neuron dendrite and the 10 concentric circles outside the cell body,that is,the total number of intersections.Briefly,we use the total intersections to express the richness of the neuronal dendrite.Calculating the number and density of dendritic spines in the 1000× field of view.Due to the inconsistent distribution of dendritic spines on various dendrites,we observed the first branch of dendrites emitted from the cell body and counted the number of dendritic spines in the 30-90 um length range of dendrites.At the same time,we observed the number of dendritic spines per 10 um,and that is the density of dendritic spines.(6)Western BlottingIn each group,8 rats,20-30 mg of HIP,PFC and 20 mg of AMG issues were fixed in 1.5 ml EP tubes,and 200-250 uL of lysate(RIPA,Beyotime,China)was added for each mg of tissue for tissue lysis(containing PMSF,which is 1%of PIPA content of lysate).Then adding 2 small steel balls(high-pressured)and placing the EP tube in the pre-cooled mill.Its parameters are 60 HZ and the grinding time is 60 s.After grinding uniformly,centrifuge in a frozen centrifuge(12,000 rpm)at 4℃ for 25 min,carefully remove the supernatant and liquor it,80 microliters per tube.BCA measures protein concentration.Before WB loading,add 5 × loading buffer and cook protein for 10 min,then add the same concentration of protein supernatant to each sample,separate the protein with 8%and 10%SDS-PAGE and transfer the protein to a 0.22 or 0.45 um PVDF membrane,and then block bands with 5%skim milk powder for 1.5 h,add primary antibody(BDNF,Abway)(H3K9me2,Abcam,ab1220)and put them in 4℃ refrigerator overnight.The next day,the secondary antibody was added after washing(TBST,three times,5-10 min per time),and incubated for 1 h at room temperature.Bands gray value analysis was used by Image J software.(7)RNA Extraction and RT-PCR20 mg of HIP,PFC and AMG tissues were placed in a 2 ml EP tube,and 500 ml of Trizol(HONBIOTECH)and two high-pressure small steel balls were added.Place the EP tube into a pre-cooled grinder to grind the tissue to no debris.Its parameters are 60 HZ and the grinding time is 60 s.Then add 500 ml of Trizol and 200 ml of chloroform,shake well until the liquid appears milky,and leave it at room temperature for 5 min to fully lyse and extract RNA.Centrifuge in a frozen centrifuge and take 400 uL of the supernatant into a new centrifuge tube,and add the same volume of isopropyl.Store at-80℃ or continue adding 75%absolute ethanol(prepared in DEPC water)to wash the pellet to obtain RNA.Spectrophotometer detects RNA concentration.The reverse transcription cDNA was loaded according to a total amount of 500 ng.Then,RT-PCR(Bio-Rad Laboratories,USA)was performed.Calculation method is 2-ΔΔCT.Primer sequence Rat-Bdnf-F GTCCCGGTATCAAAAGGCCA;Rat-Bdnf-R ATCCTTATGAACCGCCAGCC.(8)ChIP-qPCRChromatin co-precipitation was accomplished within 1 week after the rats were sacrificed.Each group took 60-75 mg of tissue and manually cut tissue into pieces of 1-2 mm.After adding ChIP cell lysis buffer,it was manually ground into a single cell suspension.After adding ChIP Nuclearlysis Buffer and performing uL trasoniclysis,the ideal chromatin fragment obtained is 150-1000 bp.Then perform IP reaction.After overnight treatment with magnetic beads and antibodies,de-crosslink,DNA’s purification kit to obtain purified DNA and to perform ChIP-qPCR.Calculate the enrichment rate.This technology is to further prove the relationship between H3k9me2 and the BDNF gene promoter,so that it is clear that H3K9me2 will directly regulate the BDNF gene and participate in the expression of BDNF protein.Primer sequence BDNF-PF 5’ TGATCATCACTCACGACCACG 3’;BDNF-PR 5’CAGCCTCTCTGAGCCAGTTACG 3’.Results:(1)Traumatic stress in adolescence led to PTSD-like behaviors,such as anxiety,depression,social interaction and cognitive dysfunction of rats,and these abnormal behaviors persisted to adulthood.The use of the small molecule inhibitor Unc0642 of histone methyltransferase can alleviate these behaviors in rats.(2)Traumatic stress in adolescence affected the abnormal dendritic morphology in HIP,PFC and AMG and these changes were observed in adult rats.The use of the small molecule inhibitor Unc0642 of histone methyltransferase can improve the dendritic development in adolescent of HIP and PFC of rats,however,there no improvement in adult groups.The use of the small molecule inhibitor Unc0642 of histone methyltransferase can improve the dendritic development in adolescent and adult of amygdala of rats.(3)Traumatic stress in adolescence led to the increased level of H3K9me2,decreased expression of BDNF mRNA and BDNF,and these changes persisted to adulthood.The use of the small molecule inhibitor Unc0642 of histone methyltransferase could improve the corresponding molecules in each brain regions.Conclusion:Adolescent truamatic stress in male rats can induce PTSD-like behaviors and such symptoms can persist into adulthood.In addition,epigenetic modification factor H3K9me2 regulated the Bdnf gene promoter to silence gene expression that lead to decrease in BDNF mRNA and BDNF expression levels and abnormal neuronal dendritic development in the HIP,PFC and AMG regions.These changes are the mechanism by which early stress experience increases the susceptibility to post-traumatic stress disorder. |
PDF Full Text Request