| Jatropha curcas L.is an important bioenergy tree species because of its high fruit oil content and suitable oil composition for biofuel production.However,the low ratio of female-to-male flowers of J.curcas(about 1:30~1:10)has led to low seed yield,which has become an essential reason limiting its large-scale cultivation and development.Gibberellins have significant regulatory roles in the development and differentiation of J.curcas flower organs and regulate the ratio of female-to-male flowers in J.curcas.GASA(gibberellic acid-stimulated in Arabidopsis)is a family of gibberellin-inducible genes found in plants that play an essential role in flower development and are also involved in a variety of phytohormone signaling pathways.At present,majority of studies on GASA family genes have been limited to the spatial and temporal patterns of gene expression,analysis of transgenic plants and raw letter analysis of the whole gene family,and there are few studies on GASA gene promoters and lack of understanding of their molecular regulatory mechanisms.In our previous study,we cloned a J.curcas GASA family gene,JcGAST1,which is involved in the development of J.curcas male flower tetrads and mononuclear pollen grains,and promotes filament growth,but the regulatory mechanism of JcGAST1 gene is not clear.Therefore,in this study,we cloned the promoter of JcGAST1,investigated the structure and function of the promoter,and explored its potential regulatory network,providing theoretical basis for in-depth study of JcGAST1 gene regulation mechanism and gibberellin regulation of J.curcas flower development.The main findings are as follows:(1)The upstream 2 249 bp promoter sequence of JcGAST1 gene was cloned using J.curcasea DNA as template.Plant CARE and PLACE prediction revealed that the promoter not only contained TATA-box core cis-element and CAAT-box basic cis-element,there are also several phytohormone response cis-elements(TCA-element,GARE-motif,TGA-element,CGTCA-motif),light response cis-elements(Box 4,G-box,G-box),stress response elements and tissue-specific elements(flower,leaf,root).(2)According to the distribution of main cis-elements in JcGAST1 promoter,four promoters with length of 1 799 bp,1 215 bp,713 bp and 359 bp were obtained by 5’-end deletion amplification.The cloned promoter full-length and deletion fragments were used to construct expression vectors incorporating GUS genes,respectively,and transiently transformed into tobacco leaves.The GUS histochemical staining revealed that the core region of JcGAST1 promoter was between-713~-359 bp.The GUS quantitative results showed that salicylic acid(SA),autin(IAA)and methyl jasmonate(Me JA)inhibited promoter activity,while gibberellin(GA)enhanced promoter activity.It was tentatively determined that there were SA negative regulatory elements at-1 215~-359 bp,IAA and Me JA negative regulatory elements at-713~-359 bp,and GA response enhancement elements at-1215~-713 bp of the promoter.(3)Based on the positions of the core region,GA response cis-element and Me JA response cis-element in the promoter of JcGAST1 gene,the promoter was again subjected to5′-end deletion,cis-element internal deletion and cis-element point mutation,and transiently transformed tobacco leaves.The core region of the JcGAST1 gene promoter was further determined by GUS staining to be located at-381~-359 bp,with the core sequence: "AATAACCAGTGAAATTTGTTGT",a total of 22 bp,and without any typical TATA-box element,belonging to the TATA-less promoter.The GUS activity assay showed that the GA response cis-element was located at-1 215~-794 bp,and the Me JA negative regulatory cis-element CGTCA-motif was located at-658~-653 bp.(4)The Me JA response element(CGTCA-Motif)of JcGAST1 gene promoter was constructed into p HIS2 vector with 10 tandem repeats,which was used as bait vector for yeast single hybridization screening.As a result,four transcription factors(Jc SAP8,Jc RGA1,Jc AHL19,Jc IAA9)were screened to bind to the CGTCA-motif cis-element.Further validation using dual-luciferase assay revealed that transcription factors Jc SAP8 and Jc AHL19 bind to the CGTCA-motif cis-elements,and thus regulate the expression of JcGAST1 gene.Therefore,JcGAST1 may be extensively involved in plant growth and development(including flower development),phytohormone signaling response,biotic and abiotic stress response and other life processes through these two transcription factors. |