The Research Of Association Between BcL-I β-fibrinogen Polymorphisms And Ischemic Cerebral Vascular Disease In Chinese Northern Nationalities | Posted on:2006-10-15 | Degree:Master | Type:Thesis | Country:China | Candidate:X L Ma | Full Text:PDF | GTID:2144360155952590 | Subject:Neurology | Abstract/Summary: | PDF Full Text Request | Ischemic cerebral vascular stroke is one of the clinical commonand frequently-occurring diseases. Because some focal of the brainblood is cut off or not insufficient, it lead to the pathology changetaken place in this focal nerve tissue. 50-70% of the persons whosurvive leaves over such serious neural flawed or damaged functionsas limbs paralysing, language function obstacles, etc. Ischemiccerebral vascular disease have high incidence, high to disable rate,high characteristic of death rate. It endanger human health, influencepatient life quality seriously and bring the heavy financial burden tosociety and family.To investigate the association of β-fibrinogen BcL-Ipolymorphisms and plasma fibrinogen levels with cerebral infarctionin different Chinese northern nationalities and populations. Ourcountry is a multi-nationality one and the northern nationalityoccupies very important position. The distribution of the cerebralinfarction incidence rate present the north high south low trend in ourcountry, thus study that the north of our country is not togethernational, not colleague crowd β-fibrin original gene BcL-Imuchform and the fibrin raw water of blood plasma level and the relation ofthe ischemic brain disease of blood vessel, for expound our countrydifferent region crowd in β-fibrin original gene BcL-Ithe distributioncharacteristic of much form have very good representative. To exploregenetic susceptible of cerebral infarction and its pathogenesis and toprovide evidence to gene diagnosis, prevention and therapy in theearly stage. It will help us to clarify the characteristic distribution ofβfibrinogen polymorphisms in Chinese different northern areas andto offer some new clues for studying human genome diversity. The plasma fibrinogen (Fg) is one of the most important bloodcoagulation factor formated and secretedby the liver cell. Fg is a largeglycoprotein dimer with a molecular weight of 340KD, each dimer isformer by three pairs of polypeptide chains known as Aα,Bβ,γ-chainsarranged symmertrically. The three genes encoding the three chainsare located in a cluster of about 50kb on the long arm of chromosome4. It accounts for 2-3% of total albumen of plasma and plays animportant role in the blood coagulation, artery sclerosis and firinolysis.The genes are under such stringent transcriptional control that if onechain is overexpressed, the other two will update, thus increase thesynthetic and secretion of the fibrinogen. The βchain may be the mostprominent chain in monomer assembly, thereby making it as thenuclesting chain. Fibrinogen mRNA, B βof chain synthetic toconsidered to be the thing whole speed limit step that memberformates, so at present domestic and international studies have beenconcentrate to B βchain, which is about fibrinogen gene expressionand adjustment. The subjects were random selected from the north threedifferentkinds of nationality (the Han nationality, the Mongolnationality and Korean nationality), who were selected from February2003 to October 2003. They respectively come from the outpatientsand inpatients of neurology department in first hospital of Jilinuniversity, the Xing'an hospital of Inner Mongolia AutonomousRegion and the affiliated hospital of Yanbian medicine college. TheHan nationality, the Mongol nationality and Korean nationality 170cases of cerebral infarction patients and 150 cases the healthy contralthese three kinds of nations. The cerebral infarction group diagnosisaccords with the criterion made in the forth cerebral vascular diseasemeeting in 1995 and confirmed by head CT or MRI. The healthcontrol group have no hypertension, diabetes and hyperlipdemia. Each nationality was divided into the health control group andcerebral infarction group, and obtained enough sample to collectplasma for assaying. Fg level. Plasma fibrinogen levels (g/l) wereassayed by tissue thromboplastin. Blood cells were used to drawgenome DNA. Primers synthesized by Cybern had the followingsequences: primer1: (5′-3′) ACCTGGTTTCTCTGCCACAAG,primer2: AATAGTTCT CATACCACAGTGT. The polymorphisms ofBcL-I βfibrinogen gene was detected by polymerase chainreaction-restriction fragment length polymorphisms (PCR-RFLP).Two allele, B1and B2, were detected at 2500bp and 1100bp+1400bprespectively. Then calculated each allele gene frequency separately(expressed with decimal). SPSS software was used in the statistics. The t test was used tofibrinogen level. Genotype frequency and allele frequency amongcases and control subjects were counted and compared by the χ2 test.P<0.05 was significance for the difference. Because B2B2 genotypeexample count too little, incorporate B2B2 genotype into B1B2genotype, (B1B2 +B2B2 ) was regard as B2 allele versus with B1B1genotype. The experimental results show that the Plasma fibrinogen levelsin cerebral infarction cases were evidently higher than those healthycontrols (p<0.05). The frequence of genotypes B1B2 and B2B2 allelewas higher in cases with cerebral infarction than in healthy controlcases (p<0.05). The Plasma fibrinogen levels in the samples ofgenotype B1B2 and B2B2 was higher than that in the samples ofB1B1 (p<0.05). But there were no significant difference about theplasma fibrinogen levels among different Chinese Han nationality, theMongol nationality, the Korean nationality in northern nationalities(p>0.05). The reseason may be these crowds relatively limited ininhabitation areas, and the nationality comes from homologyorigination (belonging to northern the Mongolian race). We draw the following conclusion according to this study: Thereis significant association between the fibrinogen plasma levels andcerebral ischemic disease. There was no significant different in BcL-Ifibrinogen polymorphisms and plasma fibrinogen levels amongdifferent northern nationalities of Chinese. β-fibrinogen BcL-I gene...
| Keywords/Search Tags: | fibrinogen, BcL-I gene polymorphism, cerebral infarction, ischemic cerebral vascular disease, nationalities | PDF Full Text Request | Related items |
| |
|