| ObjectivesTo modify the patients of defect of dentition and edentulous jaws, we established a rat model of different bite force for the study, left maxillary molars of Wistar rats were extracted and the left mandibular molar area was used as the model of the bite force lost. We detected the model rats'many kinds of cytokines in the periodontal ligament cells, in order to imitate the conditions of pathological periodontal ligament. The objective was to approach the extent and mechanism of the periodontal ligaments damagements, to get the message of the significance what the cytokines concentration have changed, so we can hope to provide reference in the clinic therapy.Material and Methods1. Animals groupingThe animals were devided into 9 groups by random, according to normal, lost biting after 6,24,48,72 hours, and 1, 2, 3, 4weeks.2. Tissue collection preparationThe animals were sacrificed, took out of their mandibulas, only needed the molar bones, fractionated two groups, one was for immunohistochemistry staining, and another was for RT - PCR staining.3. SP immunohistochemistry stainingAccording to the program of the SP kit instruction, we applied two steps, the working concentration of iNOS antibody was 1:100.4. RT-PCR detectionWe used Trizd to extract all of the RNA from the collected tissues, then detected the RNA content and purity in the ultraviolet light of 260nm and 280nm wavelength. Primer design: PrimerA (bp2541): 5'-GAGCGAGTTGTGGATT-GTTC-3';PrimerB(bp2965C): 5' -TAGGTGACCACAGCCACAGT -3;The length of amplification fragment was 425bp,Tm55Tl. In accordance with (B - ac-tin: upstream: 5' - TTACCGTGCGTGTCTTCTGG - 3 ';downstream-. 5' -GATGGCTTGAAGAGGTGTCT - 3 * ,21 -770 PCR Long750bpo RT - PCR production detection :1. 5% agarose gel electrophoresis.Results1. The results of HE staining;In the group of lost biting force, the derangement of periodontal ligament and resorption of alveolar bone were observed after 6 hours, especially in the 3r week.2. The results of immunohistochemistry staining;In the group of lost biting force there were a lot of iNOs articles, while small amounts in the group of normal , the detection of optical density showed: the mean of normal was 0. 2006, the statistics results suggested that the lost biting was concerned with the expression of iNOS ( F = 9. 845, P < 0. 01) , especially after 48 hours and 3 weeks, their means were 0. 2023 and 0.2041.3. The results of RT - PCR: the result of Dunnett Test and Paired samples Test was t = 8. 54,P <0. 01. The value of gray scales showed that the experimental groups was very different from that of the normal, the lost biting had increased 6 hours later, after 48 hours it appeared a peak, then depressed at the 1st week, but achieved the climax at the 3 week, also the forth week.ConclusionBite force lost induce the expression of iNOSmRNA enhanced apparently in PDLC and osteoblasts, it suggestes that iNOS may play important roles in the process of periodontium remodeling. |