The Investigation Into SOS1 Gene Of Hereditary Gingival Fibromatosis From Chinese Parentage

Hereditary gingival fibromatosis (HGF) is a rare oral conditioncharacterized by a slow, progressive enlargement of the gingival.HGF may manifest as an isolated finding or in associated with otherfeatures, as part of a syndrome. In most of the cases, HGF isidentified as an autosomal-dominant condition although recessiveforms are described in the literature. Conventional gingivectomy ismainly treatment available. However, recurrence is a commonfeature. Recently with the driving of genome project and thedevelopment of molecular genetics, many research workers pay theirattention to identify the gene responsible for HGF, and have made aseries of progress. However, because of heterogeneity in gene,clinical manifestation, histomorphometric characteristics, the causeand pathogenesis of HGF are constantly an outstanding question. In2002, Hart presented evidence that a single-nucleotide-insertionmutation in codon 1083 of the SOS1 gene, exon 21 is the cause ofHGF in a large Brazilian family. So we put forward a doubt that iswhether this mutation is the cause of HGF in our country. We study2 families with HGF to verify it. The method as follow: [1]collection of blood samples Peripheral venous blood ( 5 ml )was obtained by standard venepuncture from members of 2families ( family 1 , total 11 people,6 people with gingivalfibromatosis , 5 people without gingival fibromatosis;family 2 ,total 11 people,5 people with gingival fibromatosis , 6 peoplewithout gingival fibromatosis ). At the same time, Peripheral venousblood (5 ml) was obtained by same method from 11 normal people.[2] extraction of genomic DNA Genomic DNA was extractedusing Phenol-Chloroform-Isoamyl alcohol, after digestion withProtease K, and was dissolved with TE solution. It was saved at-20℃ after detection with 1% agarose gel electrophoresis. [3]polymerase chain reaction (PCR)primer 1: 5′—3′ AGGGCTTTAGCAAAATAGAATGTTprimer 2: 3′—5′ ACTTGCAGATTTTAAGACTGATCTreaction mixture: template DNA 0.5μg, primer 1 37.5pmol,primer 2 37.5pmol, TaqDNA polymerase 2.5U, 10mMdNTPmixture 1μl, buffer(without Mg2+) 5μl, Mg2+ 3.0mM, ddH2O32.5μl. reaction condition : 94℃ 5′;94℃ 30′′, 50 ℃ 30′′, 72 ℃1′,30 cycles , 72 ℃ 10′ ( final extending ). PCR products weredetected with 0.8% agarose gel electrophoresis. [4] Southernblotting hybridization The Klenow fragment of E. coli DNApolymerase Ⅰ was used to label synthetical oligonucleotide. Onetemplate oligonucleotide was 5' -3' TGCACCAAATTCTCCCAAGAACACCGTTA and the other was 5'-3 ' TGCACCAAATTCTCCAAGAACACCGTTA;The radioactive oligonucleotideprobe synthesized with 5'-3 'primer ACGGTGTT could be used todetect PCR products. The results as follows: [1] result of PCRAgrose gel electrophoresis of all PCR products ( 2 families ) showedone clear line which meant that the longth of DNA was 750pb,so wecan say there was no deletion or insertion in PCR products. [2]result of Southern blotting hybridization Among 13 familymembers with typical HGF symptoms, there were 5 cases whoseSOS1 gene mutation was detected, as Hart et al. has reported ,whilethis mutation was not confirmed for the rest cases . For 9 familymembers without typical HGF symptoms and 11 normal controls, noSOS1 gene mutation was detected. So we can draw conclusions :[1] SOS1 gene is one related gene of HGF in our country. [2] Therewas mutation of SOS1 gene, exon 21, among members of 2 familieswith typical HGF symptoms. But maybe there is difference between2 families. [3] Members of 2 families with typical HGF symptomshave a insertion mutation of one cytosine between the 126,142th and126,143th nucleotide of SOS1 gene exon 21,which has beenconfirmed in Brazil blood lineage previously. Besides,there is maybeanother mutational site including basic radicals. [4] HGF could bea hereditary disorder resulting from multiple virulence genes. Now,there are more question that need us solve:We have confirmmutation of SOS1 gene, exon 21, in our country, but we do not knowwhere or which base mutation is, and whether there is mutation ofanother gene or there are some mutations at the same time. Inaddition, it is not clear-cut that the regulation and control of HGFrelated gene expression, interaction between genes and the structureand function of corresponding protein. Finally, we should researchthe methods of gene diagnosis and gene therapy. The topic hassome clinical significance:HGF is a rare disease and do notendanger the lives of patients. Incidence rate is only 1/175000 inforeign country, but that is perhaps higher in China. Moreover,members in family have same opportunities with HGF, and treatmentis not available. Today, with the development of medical science,medical mode has been changed, so we must diagnose and curedisease more quickly and efficiently. Gene location of HGF givesgene diagnosis and gene therapy science evidence.