| ObjectiveTo find a high-performance HPA-targeted siRNA to inhibit the expression of HPA via the RNAi experiment in vitro. TO investigate the inhibitory effect of the cell line SGC7901's invasion and metastasis ability via the millicell chamber assay and animal experiment.MethodsThe heparanase mRNA-targeted double-stranded siRNA was designed with the bioinformatics technology .RT-PCR,Real-Time PCR and Western Blotting were applied to detect the efficiency of RNAi.Millicell chamber assay and animal experiments were performed to detect the alteration of SGC7901's ability of invasion and metastasis ability.ResultsAfter 48 hours, the cells were washed and subjected to semiquantitative reverse transcription-PCR and Western blot analysis to measure levels of HPA mRNA and protein. We found that HPA siRNA significantly decresed the level of HPA mRNA and the protein. Following the RNA interfering,the level of heparanase mRNA was obviously descended,by the rate of (79±6.9)% and 88.4% detected by semi-quantitive RT-PCR and Real-Time PCR.HPA was not deteced by Western Blotting,which led the ability of invasion SGC7901 cell line depressed,by the rate of (61±36) % and descended in ability of peritonaeum metastasis.Conclusions1. The siRNA with the sequence of 5'GAACAGCACCUACUCAAGAUU3'can be used to inhibit the expression of HPA.2. 48 hours after transfection by 40nmol/L,the expression of HPA was significancely inhibited.3. The inhibition of HPA's expression via RNAi suppressesd the invasion of the SGC7901 cells.4. The HPA steady RNAi cell strain was descended in the ability of peritonaeum.metastasis. |