| Background and ObjectiveC-erbB-2(HER-2/neu)is a vertebrate proto-oncogene.Its structure and functions are similar to EGFR,both of them are receptor tyrosine kinase(RTK).The amplification or the overexpression of its production p185 are correlated with kinds of tumors closely.Many investigation shows that the gastric cancer with C-erbB-2 positive expression has more metastatics and invasions,which is easy to invade placenta percreta, metastasize to lymph nodes and seed to peritoneal.So, the expression of C-erbB-2 is an middle or advanced stage in the progression of gastric cancer,which is important to the judgement of the prognosis of gastric cancer.The studies on animals and the protein analysis show that the Ile/Val single nucleotide polymorphism (SNP) of human epidermal growth factor receptor-2 (HER-2 ) in transmembrane domain-coding region at codon 655,may stimulate kinase activation and cell transformation by changing its dimerization and activation.So we can conclude that the mutation of HER-2 at codon 655(A→G),which leads to the Ile/Val single nucleotide polymorphism ,maybe a kind of carcinogenic agent and may influence clinical outcomes. There are great differences between nations in many single nucleotide polymorphisms(SNPs), and the correlations of HER-2 single nucleotide polymorphisms and gastric cancer in Chinese people have not been reported.Our study try to approach the association between Ile/Val single nucleotide polymorphism (SNP) of HER-2 at codon 655 and the gastric cancer cases of Chinese people in susceptibilities ,clinical pathological features and so on.Materials and Methods1.Patients and sample collection:152 gastric cancer patients ,who were admitted to Changhai Hospital between November 2005 and March 2007,were enrolled in this study.The gastric cancer cases were all confirmed by operation and pathology.58 healthy individuals were studied as negative controls.The blood(2ml) from peripheral vein were collected from both cases and controls and stored at 4℃.2.DNA extraction:DNA was extracted from blood using DNA extraction kit (BoGuang biology).3.PCR for HER-2:The primer was designed by software and 378bp was contained . Forward : 5'– AAGCCTGTGGGTCACCCTTC - 3', Reverse : 5'– ATCGCTCCGCTAGGTGTCAG–3'.The reaction condition was: 94℃degeneration 5min,94℃(30s),62℃(30s),72℃(40s),40 cycles,72℃extention 12min.4.Purification of PCR products:using adsorption column PCR product reclaiming kit (BoGuang biology).5.RFLP genotype:the 378bp of PCR products were digested with BsmAI at 55℃for 2 hours.BsmAI gives 150bp and 228bp fragments for Val allele and a single 378bp fragment for Ile allele.There are 3 genotypes afer gel electrophoresis.7.Statistical analysis:using SAS8.2 software.Fisher's exact test ,χ2 test and Cochran-Mantel-Haenszel(CMH) test were used to analyze datas.Probability values less than 0.05 were considered to indicate statistical significance.Results1.There are 150 cases (male :108 cases ,72.00% ; female : 42 cases ,28.00 % ), the average age is 54.72±12.38 years. There are 58 controls (male :38 cases , 65.52% ; female : 20cases , 34.83%), the average age is 53.45±12.81years.Through test ,there are no significant differences between cases and controls. 2.Compared with the genotype Ile/Ile , the risk of the genotype Val/Val is significantly enhanced with OR:4.74 (95% CI 0.59-3.82). the OR of Ile/Val is 1.85(0.88-3.92).The allele Val in cases is more frequent than that in controls( P=0.0297).3. Through Cochran-Mantel-Haenszel test ,the distribution of Ile/Val and Val/Val in TNM stages has no statistical significance.4.The distribution of genotype in different sex and positive family history has no statistical significance.5.Through Fisher's exact test, the positive expression rate of HER-2 protein in Ile/Val,Val/Val genotype is higher than that in Ile/Ile genotype ,and the results are of statistical significance (p=0.0104).6.There are no correlations between HER-2 genotypes and the expressions of nm23,p53,Ki-67,TOPII. (P=0.9252,0.9953,0.9894 and 0.9794 respectively)Conclusion1.In gastric cancer cases,the frequencies of Ile/Val or Val/Val genotype are enhanced.2.The risks of Ile/Val or Val/Val genotype are enhanced.3. The distribution of Ile/Val and Val/Val in TNM stages has no statistical significance.4. The positive expression rate of HER-2 protein in Ile/Val,Val/Val genotype is higher than that in Ile/Ile genotype.5.There are no association between the distribution of genotype and the expression of nm23,p53,Ki-67,TOPII. |