Influence Of Eradication Treatment For Helicobacter Pylori Infection On The Intestinal Microflora By 16S RDNA Sequence Analysis

ObjictiveThe aim of this study was to investigated ecological disturbance of intestinal microflora caused by H.pylori triple therapy and its impact on gut microflora.The present study was to use sequence analysis of 16S rDNA genes to investigated changes in the intestinal microflora resulting from administration of an eradication regimen for Helicobacter pylori infection using proton pump inhibitor (PPI),amoxycilin and clarithromycin.By study the triple therapy in eradication treatment for H.pylori infection on the impact of intestinal microecology,it is important for guiding clinical administer,study new anti- H.pylori infection therapy regimen and reduce side effects of drug.To provide research evidence for establish a rapid diagnostic method based on gene chip,which would apply to detect microorganisms in environmental and clinical specimens.Methods1.Study participantsFor about 20 to 25 volunteers were infomed to carry out ¹³C-urea breath test,it qualitatively detects active infection with sensitivity and specificity of more than 90 percent and the test without any damage to the body.The volunteers were signed a written informed consent form and these volunteers were recived a questionnaire survey.Eligible volunteers were selected based on the following criteria:patients with ¹³C-urea breath test positive and took no any antiacids,probiotics,antibiotics and/or antimicrobial agents 5 weeks prior to the study,had no other organic diseases of the digestive system and no previous surgical procedures on the digestive tract,no alcoholism,no diabetes or any other problem that could affect the intestinal flora. Finally,there were 12 eligible volunteers involved in the study,including 8 men and 4 women,with a mean age of 34 years(range 23-58 years).The informed consent was obtained from all volunteers.Twelve volunteers with H.pylori infection was verified by a positive urease test were administered orally,for 7-d standard triple therapy(amoxycilin 1000mg bid, take after meals;clarithromycin 500mg bid,take after meals;rabeprozole 20mg bid,take before meals )at the First Affiliated Hospital of ZheJiang Unicersity School of Medicine,HangZhou,China.The side effects of the drug were observed and recorded throughout the treatment period.These individuals were lived on a Chinese diet as usually they does during the treatment.All the volunteers were not took any other antiacids,probiotics,antibiotics agents during the treatment and underwent a ¹³C-breath test to assess the eradication of H.pylori infection four weeks after treatment.2.Sample collectionAn accurately weighed 10g portion of stool samples were collected from each volunteer before(day 0),1 day after(day 8) take medicine.Each fecal sample was mixed well and diluted in 10ml of 0.9%sodium chloride and to reserve immediately in 1.5ml frozen tube(1ml per tube,10 tube total per fecal sample )and frozen in liquid nitrogen.After the entire specimen collection,all samples were transported to the laboratory of Chief of Department of diagnosis,National Institute for Communicable Disease Control and Prevention(NICDC),China CDC.All fecal samples were frozen at -72℃.3.Bacterial DNA extractionThe total DNA from each diluted fecal sample(0.5ml,about 0.5g stool) was extracted by GENMED Stool Bacterial DNA Isolation Kit(GENMED SCIENTIFICS INC.U.S.A) as described by the manufacturer's instruction.The concentration of nucleic acids was detected by using UV spectrophotometer(Eppendorf AG,Germany) at 260nm.4.Amplification of bacterial 16S rDNA and purification of productsThe near-full sequence of bacterial 16S rDNA were amplified with two-universal primers 8F(5'AGAGTTTGATCCTGGCTCAG 3',Designed for most eubactria,E. coli positions 8-27) and 1492R(5'ACGGTTACCTTGTTACGACTT 3',Designed for enterics and most eubactria,E.coli positions 1492-1512),which are specific for universally conserved bacterial 16S rDNA gene sequences.The PCR reaction mixture,containing 0.5μl of 2.5u ml^-1 EX Taq polymerase(TaKaRa Biotechnology (Dalian,China) Co.,Ltd.),5μl of 10×EXTaq Buffer(plusMg²⁺),4μl of dNTP mixture(2.5MM each),0.5μl of 10μmol L^-1 each primer,0.5μl of 2.5mg ml^-1 8-methoxypsoralen(Sigma Aldrich Chemie GmbH,Steinheim,Germany:),was made up to 49μl with DNA-free water.A DNA suspension was added last in a 1μl volume after irradiation of the PCR reaction mixture with UV light:The tubes containing the PCR mixture were irradiated from above at a distance of 1 cm with long-wave (320 nm) UV at room temperature.After an initial denaturation step of 95℃for 5min,samples were subjected to 25 cycles of denaturation at 95℃for 30s,annealing at 52℃for 60s,and extention at 72℃for 90s,with an additional step extentional at 72℃for 10min.Amplification was carried out by using a My Cycler^TM thermal cycler(Bio-Rad CO.,U.S.A).PCR products were confirmed using 1%(wt./vol.) agarose gel electrophoresis in 1×TAE buffer(40mM Tris,20mM acetic acid,1mM EDTA,pH8.3)after GelRed^TM staining(Biotium,inc.,Hayward,U.S.A)and images captured by using a GelDoc image(Bio-Rad CO.,U.S.A).About 1.5kb size of DNA band was observed from all the 24 PCR amplicons of fecal samples.The 1.5kb DNA band was excised from the gel and the DNA was purified with a QIAGEN PCR gel Extraction Kit according to the manufacturer's protocals.5.Construction of 16S rDNA clone libraries and sequence analysis The purified PCR products were ligated into pGEM-T easy vector (Promega,Madison,USA) and then transformed into E.coli DH5a competent cells as described by the manufacturer's instruction(TIANGEN BIOTEC CO.,LTD,Beijing, China).Recombinant colonies were grow on Luria-Bertani(LB)agar plates which contained 100mg ml^-1 Ampicillin,20mg ml^-1 X-Gal and 24mg ml^-1IPTG(TIANGEN BIOTEC CO.,LTD,Beijing,China).One hundred white colonies were randomly picked from each sample and growm in LB plates containing 100mg ml^-1 Ampicillin. Sequening of colonies carried out by the Tsingke Biotec CO.,LTD,Beijing,China. The sequence were examzed for possible chimeric artifacts using the programs CHIMERA-CHECK.Each 16S rDNA sequence(mostly around 1500 base pairs) was analyzed by BLAST search against GenBank(http://blast.ncbi.nlm. nih.gov/Blast.cgi) and by using the Ribosomal Database Projectâ…¡(RDP,http:// rdp.cme.msu.edu/).If a sequence was well-matched within two datebases,the clone was placed into the corresponding taxon.If a sequence was not macthed each other within two datebases,it was determined which sequence in RDP were the most similar.6,Statistical analysisStatistical analysis was performed using Chi-square test,to compare pre-treatment and post-treatment changes in the characteristics of the kinds of bacterium.Only p＜0.05 were considers as significant differences were considered (use SPSS 11.0 for statistical analysis).Results1.Adverse events of the volunteers during the treatmentThe habits of defecation of the volunteers in the usually condition is solid and rather hard.In this study severe diarrhoea was never observed during the treatment.The most common adverse events were mild diarrhoea,taste disturbance and mild abdominal pain.During the week of triple-drug regimen,diarrhea and loose stools were reported by 10 volunteers,taste disturbance were found in 3 volunteers,2 volunteers experienced mild abdominal pain and 1 volunteer experienced constipation,in no case leading to discontinuation of treatment.2.Aanlysis of the intestinal microorganism profiles according 16S rDNA librariesTotally,39 different kinds of genera from a total of 2400 clones were randomly selected from fecal samples were identified based on 16S rDNA sequence homology search through GenBank and RDP database.The predominance genera of the facal samples before treatment were found to be Bacteroides spp.,Lachnospiraceae Incertae Sedis,Peptostreptococcaceae Incertae Sedis,Ruminococcus spp.,Parabacteroides spp.,Faecalibacterium spp.,Escherichia coli,Roseburia spp.,Alistipes spp.,and Streptococcus spp.that included more number than other genera.The major genera of the facal samples after completion of the therapy(on 8 days) were found to be Bacteroides spp.,Shigella spp., Lachnospiraceae Incertae Sedis,Parabacteroides spp.,Escherichia coli.,Klebsiella peneumoniae,Faecalibacterium spp.,Citrobacter spp.,Peptostreptococcaceae Incertae Sedis and Ruminococcus spp.that included more number than other genera. In this study,Bifidobacterium spp.,Lactobacillus spp.,and yeast were not detected.The study shows immediately after treatment,the number of obligate anaerobe (χ²=51.040,p=0.000 ) are decreased significantly while the facultative anaerobe (χ²=190.678,p=0.000 ) and aerobe(χ²=18.182,p=0.000 ) are increased than before treament.As compared with before-therapy,the number of normal flora (χ²=83.619,p=0.000 ) are strongly suppressed and the number of opportunistic pathogen(χ²=124.101,p=0.000 ) such as Escherichia coli.and Klebsiella spp.are increased significantly after-therapy,and pathogenic bacterium(χ²=468.127, p=0.000 ) such as Shigella are increased significantly after treatment.The pathogenic bacterium Campylobacter was detected on one individual(volunteer F) only after treatment,which was not detected on any other individual before treatment.ConclusionsFrom our observation it can be concluded that there has been a negative effects on the normal intestinal flora in 12 Chinese volunteers because of marked ecological disturbances in the normal gut microflora that may lead to overgrowth of opportunistic pathogen and pathogenic bacterium and may decreased colonization resistence which associated with administered antimicrobial agents during the triple-drug regimen eradication treatment for H.pylori infection.This aspect should be taken into consideration when an antimicrobially based treatment for H.pylori infection in the clinical practice.In recent year,some study have indicated probiotics and prebiotics in H.pylori eradication has been used supplementally for the protection of ecologic balance of gut microflora while releasing the severity of the antimicrobial agents adverse effects and increase patient compliance,may be this is a way to improve the disturbance of intestinal microflora during treatment with antimicrobial angents.Our stduty have no further evidence that whether there is a long-term impact on the gut microflora ecosystem after eradication H.pylori with antibiotics,but one study have indicated that the suppression of nomal intestinal flora had almost reversed 35 days after the initiation of treatment for H.pylori infection.Future studies should pay attention to whether the present H.pylori triple therapy will result in persistent changes in colonization resistence pattern of intestinal microflora.