Font Size: a A A

Silencing GnT-V Inhibit Proliferative And Invastive Ability Of CNE-2 Cell Line

Posted on:2012-10-15Degree:MasterType:Thesis
Country:ChinaCandidate:Y H LiFull Text:PDF
GTID:2214330374454223Subject:Oncology
Abstract/Summary:PDF Full Text Request
BackgroundNasopharyngeal carcinoma(NPC) is one of the most common malignant tumors in our country, mainly happened in South of China. There is apparent race and family assembling in NPC disease incidence.It is estimated that about 80% of NPC in the world took place in our country. The incidence of NPC holds the first place in cephalo-trachelian tumor, and the age of onset is between three to eighty-four, mainly in 30-50 age range. The incidence of male is two or three times as high as that of female. Now, NPC has become one of the top ten life-threatening malignant tumors in our country.The great majority of NPC is poorly differentiated squamous-cell carcinoma, and much of them is temperate sensitive to radiation, while their proximal structure has a higher tolerance to radioactive ray. So the major treatment to NPC nowadays is radiotherapy combined with chemotherapy. But there are different radiosensitivity existing in different patients,so that the therapeutic efficacy is different.There are many factors could effect cellular radiosensitivity. Apoptosis is one of the important factors. Sine apoptosis has been found by Kerry in 1972, more apoptosis controlling gene like Bcl-2 have been found. So that the apoptosis mechanism of NPC cells is promoted.Glycosylation is one of the most common post-translational modifications in eukaryotic cell surface. Changes in the expression and structure of carbohydrates can be considered as a universal feature of malignant transformation. In tumor cells, alterations in cellular glycosylation may play a key role in their metastatic behavior. These aberrant glycosylation most often arise from changes in the expression levels of glycosyltransferases in the Golgi compartment of cancerous cells. Increased branching of N-linked oligosaccharides is often associated with metastasis, due, in part, to the deregulation of N-acetylglucosaminyltransferaseⅤ(GnT-Ⅴor Mgat5; the enzyme that leads toβ1,6G1cNAc branching of N-glycans). Studies have demonstrated that increased GnT-Ⅴactivity and its glycan products are associated with enhanced cell motility, invasiveness and in some cases metastatic potential .For example,the expression of GnT-Ⅴhas the positive correlation with breast cancer, hepatoma, Neuroblastoma, cholangiocarcinoma and colon carcinoma and so on, while it has negative correlation with NCSLC.RNA interference (RNA interfering, RNAi) is a target gene sequence homology with the double-stranded RNA (double-stranded RNA, dsRNA) triggered widespread in vivo sequence-specific post-transcriptional gene silencing process. Cell ribonucleaseⅢfamily member of, dsRNA-specific nuclease Dicer cleavage of the dsRNA into 21-25 nucleotides by a small interfering RNA (small interfering RNA, siRNA), followed by a mediated siRNA Degradation caused by the same promoter sequence specifically mRNA, thereby blocking the expression of the corresponding gene transcriptional gene silencing mechanism.Molecular -targeting therapy in cancer is based on the molecular and cell biology, The targets are tumor tissue or cells with a specific (or relatively specific) structural molecules,and it is a class of therapy that we use specific binding Antibody, ligand or targeting these molecules to treat directly. These drugs targeting some of the tumor cell membrane or cell-specific expression of the molecular, can be more specifically treat the specific tumor cells and control the tumor by blocking its growth, metastasis, or inducing apoptosis, inhibiting or killing tumor cells.ObjectiveTo construct expression vectors of small haired RNA aimed at GnT-Ⅴgene, which was higly expressed in colorectal cancer, and to investigate effects of GnT-Ⅴ shRNA on proliferation, adhesion, migration and invasion of high metastatic potential CNE-2 cell line. By this way, it can offer objective proof to identify new target in molecule-targeting treatment of nasopharyngeal carcinoma.Methods1,Construction and identification of pGPU6/GFP/Neo GnT-ⅤshRNAFinished by Shanghai GenePharma Co.Ltd2,Cell culture and transfectionHuman colorectal cancer cell line CNE-2 was cultured in RPMI-1640 containing 10% newborn cow serum, in the condition of 37℃5% CO2. When CNE-2 cells were cultured to exponential growth phase, Lipofectamine 2000TM was used to transfect recombinant plasmids into CNE-2 cells. Stable transfectants were selected in RPMI-1640 containing G418 at 2000μg/mL.3,Tumorigenicity in nude mice2.5×105 cells were injected into subcutaneous of 3 nude mice. The tumors size was measured with calipers. Mice were sacrificed after fourteen days and the tumors were weighed. The tumor volume=(width)2 x length/24,Tumor metastasis in nude mice107 cells were injected into liver of nude mice to form animal model of NPC xenograft transplanted in liver and metastasized to lung[17]. The nude mice were sacrificed to be observed the primary and metastasis tumors after 14 days by H&E. The expression of GnT-Ⅴin liver xenografted tumors was detected by RT-PCR, western blot assay and immunohistochemistry. Both E-cadherin and bcl-2 were studied by immunohistochemistry. Each group had 5 nude mice.5,Examination of the expression of GnT-ⅤmRNA in hepatic tumor by qRT-PCR1). Total RNA was extracted from hepatic tumor with Trizol. Two micrograms of RNA were used for complementary DNAs (cDNAs) synthesis with oligo(dT) primer. The reaction was proceeded for 15min at 15℃, followed by 5s at 85℃. The cDNAs were subjected to denaturation at 94℃for 30s, followed by 40 cycles of 95℃for 5 s,60℃for 20 s,72℃for 30 s. Then 10 ul products were applied to 2.0% agarose gel electrophoresis. The products were scanned by UVItec gel documentation system (Cambridge, UK). The amplified DNA bands were quantified by quantity one. The PCR primers synthesized by Shanghai Sangon Biotech Co Ltd were as follows: GnT-V F:5'AACTCTTGGACCATCCTGGGTTC 3', R:5'TTGCTGCTTTTG GGTGGGTT 3'; p-actin F:5'GAAACTACCTTCAACTCCATC 3', R:5'CGAGGCC AGGATGGAGCCGCC 3'.2). Examination of the expression of GnT-Ⅴ,Bcl-2,E-cadherin protein in hepatic tumor by Western blotTotal protein were harvested and lysed. The protein concentration of the supernatant was determined by the BCA protein assay procedure. Twenty micrograms of protein boiled for 5minutes were electrophoresed on a 8% polyacrylamide gel and then transferred to a polyvinylidene difluoride membrane using semi-dry transfer at electrical current 90mA for 1hour. After blocked with 3% BSA+7% fat-free dry milk, the membrane was treated for 2 h at room temperature with primary antibodies(1:200-diluted antibody of GnT-Ⅴ,1:200-diluted antibody of E-cadherin,1:300- diluted antibody of bcl-2, all from Santa Cruz Biotechnology, Inc, California, USA), followed by incubation with HRP-labeled secondary antibody (Beijing Biosynthesis Biochnology Co. Ltd) for 45 minutes at room temperature, and then stained with ECL reagent. The protein bands were also quantified by quantity one.3). HE stainingThe liver tissue and lung tissue was fixed by 10% formalin. Dehyded gradually by alcohol dehydration from low concentration to high concentration, transparented by Xylene, embeded by wax. Slice and chip, after dewaxing with hematoxylin, eosin staining, dehydrated,then mounted by gum.4). ImmunohistochemistryParaffin sections after dewaxing and hydration, corresponding to the repair of tissue antigen. Add slices of endogenous peroxidase blocking agent, incubated at room temperature for 10 minutes, plus animals, non-immune serum (rabbit/mouse), incubated at room temperature for 20 minutes. Remove the serum, one drop of each section plus anti-(GnT-Ⅴpolyclonal antibody (1:200), E-Caderin monoclonal antibody (1:200), Bcl-2 monoclonal antibody (1; 300)), room temperature Incubated for 60 minutes. Add slices of rabbit biotin-labeled anti-goat IgG, were incubated at room temperature for 10 minutes. Remove the PBS solution, each slice of Streptomyces antibiotics plus protein-peroxidase, incubated for 10 minutes at room temperature. After washing, DAB solution drops of freshly prepared, observed under the microscope. Cleared by tap water, stained with hematoxylin.5). survival analysisMetastasis model with NPC xenograft transplanted in liver were applied in survival assay.107 cells of CNE-2 GnT-Ⅴ/NC and CNE-2 GnT-Ⅴ/2224 were injected into liver of eight nude mice respectively. The survival rate was recorded and the survival curve was constructed.6,StatisticsResults were analyzed by SPSS13.0 software. The values given are means±SD. Statistical analysis between two samples of GnT-ⅤmRNA and protein level, Bcl-2, E-cadherin protein levels of liver tumor tissue,was performed using two independent samples Student's t-test. Suvival time was analyzed by Wilcoxon W rank sum test.Tumorigenicity in nude mice was analyzed by two factors factorial design analysis of variance, the same group at different time points was analyzed by one-way ANOVA, multiple comparisons within the group using LSD test, the same time comparison between the two groups, Using two independent sample t-test. P<0.05 indicated statistically significant. Results:1,Tumorigenicity in nude mice has shown that subcutaneous tumor volumes were increasing (F=528.871, P=0.000), the average size of the two groups were 85.204mm3,139.860mm3.The tumors of CNE-2 GnT-Ⅴ/2224 group smaller than CNE-2 GnT-Ⅴ/NC group.Compared with the control group, CNE-2 GnT-Ⅴ/2224 group, the average inhibition rate was 24.0%.2,Liver tumors from CNE-2 GnT-Ⅴ/NC could be observed obviously, while liver xenografted tumors were eatablished in both groups by hematoxylin-eosin staining (H&E). RT-PCR, western blot and immunohistochemistry showed the expression of GnT-Ⅴwas less in group CNE-2 GnT-Ⅴ/2224 than group CNE-2 GnT-Ⅴ/NC, and GnT-ⅤmRNA and protein of CNE-2 GnT-Ⅴ/2224 were decreased by 68.3% and 63.7%. Thoracic cavity hematocele could be found in mice injected by CNE-2 GnT-Ⅴ/NC, however, there were no abnormal phenomena observed in lung of mice injected by CNE-2 GnT-Ⅴ/2224. The results of H&E confirmed no lung metastasis tumor in group CNE-2 GnT-Ⅴ/2224 was found.3,Thoracic cavity hematocele could be found in mice injected by CNE-2 GnT-Ⅴ/NC, however, there were no abnormal phenomena observed in lung of mice injected by CNE-2 GnT-Ⅴ/2224. The results of H&E confirmed no lung metastasis tumor in group CNE-2 GnT-Ⅴ/2224 was found..4,No significant difference of E-cadherin protein was found between CNE-2 GnT-Ⅴ/NC and CNE-2 GnT-Ⅴ/2224.The expression of bcl-2 protein in CNE-2 GnT-Ⅴ/2224 was decreased by 55.9%.contrasting to CNE-2 GnT-Ⅴ/NC. Suppression of GnT-Ⅴhad no effect on E-cadherin, but might inhibit the expression of bcl-2.5,Survival analysis showed that the median survival time of CNE-2 GnT-Ⅴ/ NC group was 18 days, and the median survival time of CNE-2 GnT-Ⅴ/2224 group was 19 days.Conclusion:1,Nasopharyngeal carcinoma cell line CNE-2 silenced GnT-Ⅴgene,whose the mRNA and protein expression GnT-Ⅴwas also reduced obviously in vivo. 2,Down-regulation of GnT-Ⅴexpression can significantly inhibit proliferation of CNE-2 cell line in vivo.3,Down-regulation of GnT-Ⅴexpression can significantly inhibit lung metastasis of CNE-2 cell line in vivo and can make the median survival time of nude mice longer.4,Down-regulation of GnT-Ⅴexpression can reduce the expression of bcl-2 protein,but donot affect the E-cadherin.5,The sequence of RNA interference against GnT-Ⅴmay be a valid target to treat NPC.
Keywords/Search Tags:GnT-V, RNAi, NPC, Metastasis, proliferation, in vivo
PDF Full Text Request
Related items