Alteration Significance Of Telomere Length Of Peripheral White Blood Cells In Patients With Obstructutive Sleep Apnea

Telomeres are complex DNA-protein structures located at the end of eukaryotic chromosomes. They are dynamic regulators of cellular life span and chromosome integrity.It is reported that through observation about the length of telomere of fibroblast and the mitotic ability among donators in different ages,the relationship between them can be found is that the mitotic ability can obviously weaken when the telomere shortens. Due to the mitosis, telomere length (TL)shortens progressively with each division until telomere length (TL))shortens to the extremity, which stop the cells division,then lead to agingn death, therefore, TL is therefore considered the deciders for the life span of cells, which is also called as a mistosis clock.Recent years, more and more research on elderly population who suffered from obstructive sleep apnea syndrome (OSAS) have been done. Obstructive sleep apnea syndrome (OSAS) is a kind of serious disordered breathing disease when sleeping, characterized by a perturbation of the pharyngeal dilator muscles, which causes frequent cessations of breathing (apneas) accompanied by a reduction in ventilation (hypopneas) during sleep accompanied by a reduction in ventilation (hypopneas) during sleep. OSAS most commonly develops in obesity and middle aged to elderly people, the highest morbidity happens to 40-50 ages, adult males morbidity is 4% while 2% in adult females, but now there is a rising trend in morbidity at 35 ages. No obvious difference can be seen between male and female at various ages. The obstructive sleep apnea syndrome (OSAS) is often reported to be associated to cardiovascular disease and, cardiac failure, cranial vascular disease and metabolic syndrome. The complications bring about of multiple organ failure, what the worst is severe patient can lose consciousness or die suddenly. Anyway, serious OASA will affect the quality of life and life span.However, people have unclear vision about the harmful impact of OASA what leads to patients'impercipient idea on early treatment and early diagnosis until complications appear at heart, cerebrum, lungs and kidney with losing good opportunity for treatment. Recently sleep medicine arised as an interdisciplinary subject together with much more attention have been payed to OSAS in medicine and all circles and the research are more profound, as a result, it is important to give patients health education for early diagnosis and early treatment.Increasing number of study reports show that telomere length have something to do with many diseases in coronary, cardiovascular and other carcinoma at stomach or liver as well as diabetes, uremia, as a result it is undoubtedly a medical breakthroughs along with putting forward various telomere length mechanism. Predictably, aging mechanism can be interpreted, life expectancy and instant age can be estimated by continuous discovering and mastering the changing rules of telomere length. Through clinical parameters and information contained in cell to investigate anoxia biological behavior, to consider TL as the diagnosis method and clinical indications, which solve the cells aging problem in tissue engineering and provide theoretical basis for OSAS。 ObjectiveTo investigate the alteration and significance of TL in the pathogenesis of OSAS.Materials and methodsSubjectsAccording to the analytic guidelines of polysomnography published by American Academy of Sleep Medicine (AASM) in 2007, case group consist of eleven patients diagnosed with OSAS and 10 healthy controls. After concentration determination, qualified samples were screened out for the experiment, then using the fluorescent quantitative PCR detection system to determine the TL relative t/s ratio.Experiment suppliesmaterialsFasting blood samples (5ml) were obtained from peripheral vein of all the subjects into eight-tubes allied, special for PCR, containing EDTA with anticoagulant and then stored at -80℃for quantitative determinations.reagent Takara Blood Genome DNA Extraction kits, Premix Ex TaqTMⅡkits(SYBR(?)), isopropyl alcohol, ethanol,ⅨTE buffer solution.T reaction primer tel1 GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGGT tel2 TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTAS reaction primer 36b4u CAGCAAGTGGGAAGGTGTAATCC 36b4d CCCATTCTATCATCAACGGGTACAAequipments wash bath, ultraviolet spectrometer, real-time q-PCR(ABI PRISM(?) 7500) [2Ct/(telomeres)/2Ct(36B4)]-1=2-ΔCtStatistical methodResults were analyzed by statistical software SPSS 13.0. Comparisons between patients and controls were performed with independent t-test. Correlations between variables were explored using the Spearman-rank test.Results1. Comparison of the relative T/S ratios of TLRelative T/S ratio of TL in patients with OSAS was 3494.71±2531.04 while 67536.01±87431.93 in healthy controls which was longer than the former group, there was significant difference between two groups (P<0.05)2. The correlativity among the relative T/S ratios of TL and age, BMI, AHI, courses of the disease, the classification of the diseaseSignificant correlation did not exist after the analysis about the relative T/S ratios of telomere length and many ariables. In healthy controls, there is negative correlation between the relative T/S ratios and age, r=-0.713, P=0.021, while no significant correlation between the ratios and BMI (P>0.05)ConclusionsThere is closely relationship between OSAS pathogenesis and the change of telomere length, which is likely to be interpreted by hyoxemia and hypercarbia, caused by chronic anoxia in sleep, can accelerate the loss of telomeres and the apoptosis of cells which have direct impact on life span.Apnea could cause hypoxemia(PO2↓), hypercarbia(PCO2↑), even decompensation of pH. The decompensation could drop as low as 60%～80%. The severe hypoxia could cause to increase of the secretion of catecholamine, catecholamine and endothelin which lead to vasoconstriction, dysfunction of endocrine and neuroregulation, change of hemodynamics and rheology. The abnormality of microcirculation aggravates ischemia and hypoxia of the tissue and organs then lead to injury of multisystemic organs. The researches to date have revealed that OSAS could cause damage to cardiovascular system, respiratory system, cerebral vessels and central nervous system, endocrinal and sexual functions, kidneys and hematological system. The underlying association of OSAS with TL is unclear so far.