Leptin/AMPKα₂/BSEP Influence Cholelithiasis Formation By Regulating Bile Acid Metabolism

Objective: bile acid dysmetabolism and infection might be an importantfactor to promote stone formation. Bile salt export pump (BSEP) is thekey of transporters for regulating bile acid excretion, the decreased BSEPexpression amount will result in the reduction of bile acid secretion andcholestasis.The expression of BSEP regulated by AMPK, is affected bymetabolic factors. Leptin is one of the hormones which regulating energymetabolism by AMPK. This experiment intend to observe the mRNA andprotein expression of Leptin, AMPKα2, BSEP among the benign liverdisease,gallbladder cholesterol gallstone patients and primary intrahepaticbile duct stonesin patients.Therefore, we have a preliminary study onregulation mechanism of the Leptin/AMPKα2/BSEP signaling pathwaywhich regulate bile acid metabolism in patients with cholelithiasis, richthe pathogenesis of cholelithiasis.Object and method:1.subjects were divided into3groups, gallbladderstones(GS) group of30cases, the primary intrahepatic bile ductstones(PIS) group of30cases, benign liver lesions (8cases of liverhemangioma,5cases of hepatic cyst,2cases of liver injury rupture,beside the exclusion of biliary tract disease, Controller, CT) group of15cases. Serum samples obtained: detection of preoperative patients morethan12hours of fasting serum leptin and total bile acid, total bilirubin, direct bilirubin, indirect bilirubin,total cholesterol,triglyceride,transaminase. The hepatic tissue samples: authorized by the ethicscommittee approval, patientsafter informed consent, cut liver acquisitionoperation after resection of the appropriate size, immediately loaded withRNA preservation solution in freezing tube, rushed to the CentralLaboratory of Affiliated Hospital of Luzhou Medical College of-80℃refrigerator freezing.2. GAPDH as internal reference,using Real-timeQuantitative PCR method for detecting the mRNAexpressionof OB-Rb,AMPKα2and BSEP.OB-RB5’primer:GCCTTCATAAGCCTACCAATGTAGA,OB-RB5’Reverser:GGAAACAAGGGACCTTCCCACTA,AMPKα25’primer:CAGGAGATGCAGTCCAGCACAA,AMPKα25’Reverser:GCCCACATCTACCTATCACATTCAG,BSEP5’primer:TCGCTTGTCCACCATCCAGAA,BSEP5’Reverser: GGGGATCCAGTGGTGACTAGTT. According to thestandard curve and the sample PCR reaction Ct value, calculation andanalysis of mRNA expression using Bio-Rad iQ5software.3, using theWestern blot method to detect OB-Rb, AMPKα2, p-AMPKα2, expressionof BSEP protein: the β-actin as a reference, choose the productAnti-Leptin Receptor antibody antibody in1:ab5593America ABCAM,AMPKα2Antibody:2532, cell signal, USA Phospho-AMPKα2:2535,Santa Cruz, BSEP Antibody USA products (P-18:sc-17294), to detect theexpression of the gene encoding protein. Expression analysis of calculation related protein image results using the Bio-Rad gel imageanalysis system and Quantity One4.4.0software. The mean±standarddeviation measurement data (xˉ±s), was analyzed by SPSS20.0software.Factorial design ANOVA was used to compare the groups, between thetwo two groups was compared with the minimum difference t test(LSD-t), if the variance not neat, the Dunnett ’s T3test, between the threegroups were compared by rank sum test, P＜0.05was consideredstatistically significant difference.Results:1.The analysis of serum indicators: compared with CT groupand PIS group, the Leptin level in serum of GS group increasedsignificantly, P<0.05,the difference was statistically significant. However,compared with the GS group, serum PIS Leptin level decreasedsignificantly, P<0.05, the difference was statistically significant.Compared with the CT group and PIS group, GSgroup, serum totalcholesterol (TC), triglyceride (TG) levels, P<0.05, the difference has nostatistical significance. Compared with the CT group and GS group, PISgroup, total bile acid (TBA), total bilirubin(TBIL), direct bilirubin(DBIL),alanine aminotransferase (ALT), aspartate aminotransferase(AST)increased significantly, P<0.05, the difference was statistically significant.2.Compared with the CT group, the expression of OB-Rb mRNAexpression in GS group, PIS groupwas decreased significantly, P <0.05,the difference was statistically significant; Compared with the CT group,the expression of AMPKα2mRNA expression in GS group, PISgroupwas decreased significantly, P <0.05, the difference wasstatistically significant; Compared with the CT group,the expression ofBSEP mRNA expression in GS group, PIS groupwas decreasedsignificantly, P <0.05, the difference was statistically significant;3.Compared with the CT group, the expression of OB-Rb protein in GSgroup and PIS group,was decreased significantly, P<0.05, the differencewas statistically significant; Compared with the CT group, the expressionof AMPKα2protein in GS group and PIS group,was decreasedsignificantly, P<0.05, the difference was statistically significant;Compared with the CT group, the expression of p-AMPKα2protein in GSgroup and PIS group,was decreased significantly, P<0.05, the differencewas statistically significant; Compared with the CT group, the expressionof BSEP protein in GS group and PIS group,was decreased significantly,P<0.05, the difference was statistically significant.Conclusion:1.The serum TBA, TBIL, DBIL, ALT, AST of PIS groupwere significantly higher than that of GS group and CT group, suggestingthat the primary intrahepatic bile duct stones acid excretion in patientswith obstacles, and affect the function of liver.2. Serum leptin levels inpatients with GS increased, but mRNA and protein expression of leptinreceptor in liver and AMPKα2, p-AMPKα2, BSEP gene decreased.GSpatients have a certain degree of leptin resistance, the formation of gallstone associated with Leptin/AMPKα2/BSEP.3.Serum leptin levels inPIS patients with decreased liver leptin receptor down-regulation, and thepresence of mRNA and proteins of liver AMPKα2, p-AMPKα2, BSEPgene expression, appear bile acid excretion disorder, cholestasis, promotegallstone formation suggest that leptin function cannot exert.Therefore,Leptin plays an important role in the development process ofcholelithiasis.Moreover, Leptin/AMPKα2/BSEP signal pathway may beinvolved in the formation of gallbladder stones and intrahepatic bile ductstones by bile acid metabolism,which may play an important role in thepathophysiology of Cholelith formation.