Font Size: a A A

Differential Display And QTL Analysis On The Genes Related To Seed Color In Yellow-seeded Brassica Napus L.

Posted on:2004-07-31Degree:DoctorType:Dissertation
Country:ChinaCandidate:L Z LiuFull Text:PDF
GTID:1103360122970795Subject:Crop Genetics and Breeding
Abstract/Summary:
Yellow-seeded Brassica napus is characterized with thinner seed coat and low hull percentage, which in turn are correlated with higher oil and proteins and lower crude fiber contents compared to black-seeded one. In China, a series of yellow-seeded lines and cultivars of B. napuswith distinguished quality traits have been bred and used in practice to date since the pioneering discovery of yellow seeds in this species by professor Houli Liu in 1975. But until now, the heredity of seed coat color in B. napus was unclear. The seed color was controlled by one to three major genes with the modification of some minor genes according to many research results. A RFLP marker tightly linked to seed color of yellow-seeded B. napus was identified, which indicated that the CHS (chalchone synthase) has great effects on the seed color of B. napus (Van Deyzne et al. 1995). However, Somer et al. (2001) obtained eight RAPD markers linked to the seed color of yellow-seeded B. napus, and the genetic distances between the yellow-seed major gene locus and the two tightly linked markers were 1. 7cM and 7. 8cM respectively.The major work of this research is using differential display and QTL analysis on the genes related to seed color in yellow-seeded B. napus. A repetitive and steady differentially-expressed cDNA fragment of 175bp (including the 13bp polyA tail) which presents up-regulation to the yellow seed trait of B. napus was obtained by screening 90 pairs of random primer/anchor primer combinations by using mRNA differential display technique in two groups of NILs (near-isogenic lines) from different origins of yellow-seeded B. napus.Northern bloting analysis of this cDNA fragment distinctly confirmed the differential expression of this gene between yellow-seeded and black-seeded lines of B. napus. Based on the sequence tag of the differentially expressed cDNA fragment, we designed 2 reverse primers GSP1 and GSP2 to combine with the anchored primer for the PCR-based chromosomal walking of the 5' sequence of this gene. These two primers are: 5' -TAGATATGTACCAGAGTCG-3' for GSP1 and 5' -GACAAAGAAGACCATGTCG-3' for GSP2 respectively. Below is the 644bp fragment sequence obtained with the two primers:ATTCGGTAGGATCCCGCAGAACGAGGCCAGGATCCTGGCCGTCCAAGACGCGTATCAATTGTGAACTTTTGAGTT TTCTCTCCCTCTCATCACCTCCCCnCCTTATATGATTGMTACGCTTCACATTGAATAGCACACAAAGTAATAA AAAAACACATGATAGAGATGATTAGGTTTACAGTATTATCATTCTTTGTTGTTTTCCTTCTCTTATTCGCTTGCA ATGAGTCTTCGGCTAAGACTGaAAGTATGATAAGTCAGATGAGTCGGACGAAAACGACGATCTCGCCGCTGTAC CGTCATGnGTGGGTTTTCATCGCCTCTTCTGATCAAGAAAGATCMTGGAAACCMTCTTCGCGAACAAGTTCG GACAGATCTCAACCGTTCAAATCGGCGATGGATGCGGCGGGATGGGCCCTTACAAAATACATTCCATAACGCTGG AACCAAACGCGCTTATGCTCCCTCnCTTCTTCATTCCGACATGGTCTTCTTTGTCGACTCTGGTACATATCTAT AATCTGCTTCAGTGTCATGTATTCAGGGTCGGATCATAGACTTTGACACCTAAATTTTTAAGAAGTAATGTATAG TTTTTTTTCTGAAMCCAAGTMTTTATATAGTTATCGTTTACC(AAAAAAAAAAAAA)Sequence analysis showed that the sequence between 293 and 514 had high homology (89%)to protein cupin(At4g36700) in Arabidopsis thalianaL. developing seed. But the function of the A. thaliana cupin protein is also unknown, hence much work should be done to obtain the whole sequence of this gene and identify its function in yellow-seeded B. napus.In the second research, we adopted F2 generation of GH06 which originated from (black-seeded B. napus x yellow-seeded B. jvncea) + yellow-seeded B. napus and P174 which was a black-seeded self-line of B. napus cultivar Youyan 2 respectively as parents to construct the genetic linkage map of yellow-seeded B. napus. A total of 295 markers include AFLP, SSR, RAPD and SCAR was screened in the p2 population. Software MapMaker and Map Manager QTX were used to construct Brassica napus L linkage groups. Finally, a linkage map was obtained with 174 markers distributed over 22 linkage groups covering approximately 2688. 5cM with an average spacing of 15. 45cM were obtained.The major traits such as seed color, protein content, hull content, 1000 seed weight, oil content and oil content in hull were tested in F2:3 families. 1) The relative va...
Keywords/Search Tags:Brassica napus L, Seed coat color, mRNA differential display, Quantitative trait locus (QTL), Linkage map
Related items