The development of new immunodepressors and clinical surgery techniques is increasing the successful rate of allotransplantation year by year, and it made the orgen transplantation being an effective way to handle with the end stage failure of the important organ such as heart, liver, kidney and so on. But the limited availability of transplantable human organs is the major barrier for the further development of the allotransplantation, which promoted the research of xenotransplantation. Although xenotransplantation (the transplantation of tissues between different species) is believed the possible method to deal with the problem of shortages of human organs, the hyperacute rejection (HAR) of pig tissues and organs, mediated by the host's immune system, remains a major barrier to successful xenotransplantation. The mechanism of the HAR mainly involves the interaction between xenogeneic natural antibody (XNA) and endothelial cell (EC). XNA in human serum would bound to a -1,3 Gal epitopes on EC of xenogenic organ, and activated complement via the classical pathway and alternative pathway, then the HAR happened and resulted in the damage of xinogenic tissue. So, the complement activation in human serum play a crucial role in the damage process of xenotransplantation.Complement regulatory protein (CRP) is a glycoprotein that widely distributed in animal serum and on surface of most cells and has a function to inhibit activity of complement. But the CRP present on the EC of xenogenic organ cannot inhibit activation of human complement due to specific restriction, which is the important reason of HAR. Using transgenic approaches to express human CRPs in the animal EC is believed to be an effective way of inhibiting complement activation and overcoming the HAR. Decay accelerating factor (DAF) and CD59 play different5roles in complement activation, are heat topics among the researches of CRPs.In order to get DAF+CD59 transgenic pigs, we constructed the endothelial -specific expression vectors of recombinant DAF and CD59 respectively; cultured the pig endothelial cells and fibroblast; transfected the pig endothelial cells and fibroblast with constructed vectors; checked out the functions of the ICAM-2 promoter and intron-1 of interesting genes in the endothelial cells; checked out the expression of human DAF and CD59 in the endothelial cells with reporter gene and flow cytometry. Also made essential theoretic and technical preparation for the research of DAF+CD59 transgenic animals.Nowadays most researchers hold the opinion that two CRPs are better than one CRP for inhibition of HAR, so we constructed DAF and CD59 recombinant plasm id respectively. However, the nonspecific promoter may affect physiology of the transgenic animals, so we substitute nonspecific promoter with endothelium specific promoter - ICAM-2 promoter. We also added intron-1 of interesting genes to increase the expression of them. These characters are different from others.I have finished the following reserch work: 1.Construction of endothelial-specific expressive recombinant vector of DAF geneExtracted human genomic DNA from human blood, pureed it as the template for the PCR amplification of ICAM-2 promoter fragment and DAF intron-1 fragment. According the reported sequence of human ICAM-2 promoter and DAF intron-1 in Gene Bank, designed two pairs of premiers respectively. The premier sequences of Human ICAM-2 promoter is PI 5'GCTCTAGACATGACTCCAACAATG 3', P2 5'GAGGTACCTTCTCTGGCAGTCTC 3'. The premier sequences of DAF intron-1 is P3 5' CGAGGTACCTGACTTACTGCAACT 3' P4 5'GGACCTACTCAGGGTGGTAAATGT 3'. For easy gene cloning, added the restriction enzyme Xbal point at 5' end of PI, Kpnl at 5' end of P2 and P3. after the6successful PCR production of the two fragments, digested them and PSFFV-DAF vector with restriction enzymes respectively and formed the directed cloning end . ligated these fragments into the PGEM-TNf vector with T4 DNA ligase and got target recombinant endothelial-spe...
|