| ObjectiveHypertension is one of the most serious complex diseases nowadays that threaten public health and may lead to a series severe results such as cardiac and renal failure and shock. Hypertension is a complex disease resulting from the interaction of the cumulative effect of multiple genetic and environmental factors with genetic ones being important. Along with the completion of human genome project, it has been a key aim to study the sequence variations that correlate with certain diseases. As the third generation of genetic markers, single-nu-cleotide polymorphism (SNP) is characterized as large numbering and wide distributing. SNPs or haplotypes that are related to diseases may be obtained through systematically identifying SNPs especially those in coding and regulating region and the case-control study. This will play an essential role in probing the genetic mechanisms of some complex polygenic diseases. WNK4 gene is a newly cloned protein kinase gene with the mutation in exon 7 and exon 17, which may cause Pseudohypoaldosteronism type II (PHA II) , an autosomal dominant inheritance disease. The main symptoms of PHA II are hyperkalemia, metabolic aci-dosis and hypertension. WNK4 locates on 17ql2-21, a hot locus of blood pressure regulation. Therefore WNK4 is very likely to correlate with essential hypertension. In order to investigate the relation between WNK4 gene and hypertension and its effect in hypertension pathogenesis, two SNPs in coding region of WNK4 gene were assessed in this study and also the expression regulation mechanisms and its correlations with hypertension were studied.Methods1. cSNPs were identified by relative reports and small-sample sequencing and were examined by RFLP. Then the case-control study in a large group wascarried out to determine the relation between cSNPs and hypertension.2. WNK4 gene expression levels detected by RT-PCR; RNA was extracted from fetal tissues by TRIzol reagent and was used as templates to perform RT-PCR and analyze WNK4 expression level.3. Effects of different factors on WNK4 expression; COS-7 cells were cultured 24 hours with different treatments such as recombinant human estrogen, growth hormone, Insulin, dexamethasone, angiotensinll. Then mRNA of these cells was prepared and expression of WNK4 gene in transcriptional level was detected by RT-PCR and Northern blot.4. Identification of WNK4 transcription initiation site; WNK4 transcription initiation site was identified by 5' Marathon RACE with human renal Marathon cDNA as template. 3'specific primer was designed according to WNK4 sequence in GenBank: 5 TGGGTCTCCATGTCCTCCTTTD '. Corresponding cDNA fragments were obtained by amplifying human Marathon cDNA library by PCR method. Using this PCR product diluted 50 times as template, a nested PCR was performed to identify the transcription initiation site.5. Construction of WNK4 gene pCAT-promoter reporter expression vectors: genomic DNA as template, forward primer; 5 ' CACTGACCTCTCCGTTCGGC 3' ,reward primer; 5 ' CAGATCATTCAGGGCAAAGAC 3 '. WNK4 promoters were amplified by PCR under the condition of 95 C 5min for pre-denaturation, 35cycles of 94C lmin,60C lmin,72 C IminSOs, and then 721 10 min for extension. After purification, PCR products were ligated to pMD18 clone vectors. After sequencing, the plasmid was digested by Hind III and Xbal. Purified products were ligated to pCAT vector to construct pCAT-WNK4-promoter reporter vectors.6. Cis-acting elements and trans-acting factors of WNK4 gene promoters were identified by EMSA.7. Identification of function of WNK4 gene promoter GRE; COS-7 cells were transfected through lipofectin transfection method. Cells were harvested after treatments with InM, 10nM dexamethasone and blank control respectively. CAT protein expression level was detected by enzyme-linked immunosorbant assay (ELISA).Results1. A new SNP ( G1662A) was found in exon 7 of WNK4 gene through sequencing in small samples. The genotype frequencies of G1662A and another cSNP in exon 8...
|
PDF Full Text Request