The Research On The Relationship Between Polymorphisms Of UL144,UL139,and UL149 Gene And Pathogenicity

IntroductionThe human cytomegalovirus (HCMV) can cause lifelong infection, A kinds of clinical manifestations were caused and multisystem were implicated. In the normal host, primary infection is usually mild or asymptomatic. However, Intra-uterine fetal infection and infection of immunocompromised patients are well known to result in significant morbidity. The pathogenesis of intrauterine infection and fetal malformations from CMV are not completely understood. Host factors , such as the development of a potent cellular and /or humoral response, together with viral determinants may play an important role. Why is divergent in virulence and tissue ~ tropism for different hosts. Whether HCMV genetic polymorphisms was relative to clinical outcome. The diversity of organs and cell types infected by HCMV in vivo has led to the hypothesis that HCMV disease and tissue tropism may be related to sequence variation among strains. The ease of identifying the gB genotypes by restriction endonuclease polymorphism has facilitated epidemiological studies of the gB genotype in CMV disease. There have been reports of association of gB genotype with outcome of CMV infection. But the results have not established definitive associations between gB types and HCMV disease.A new region of DNA containing at least 19 open reading frames (ORFs) was found in Toledo and several other low ~ passage clinical isolates by Cha in 1996. This region, however, is not present in the HCMV laboratory strain AD169. The fact that the clinical isolates retain the 19 ORFs suggests that the predicted gene products may be essential for viral infection in vivo. The possibility that these new ORFs may provide genetic markers for HCMV pathogenesisprompted us to investigate these genes in HCMV clinical strain.MacCormac et al reported that there was different cell tropism among isolates . The fact suggested that genetic polymorphism were found in the isolates showing all kinds of clinical manifestation. The genes of UL144 and UL139 and UL149 are located among the 19 ORFs lacking in the laboratory strains. The protein encoded by UL139 and UL149 exist in theory but their biological functions are not clear. Lesser literatures reported them. At present, some scholars study the UL144 gene by restriction endonuclease and sequencing method among low ~ passage isolates. It encodes a homologue of the herpes simplex virus entry mediator, a member of the tumour necrosis factor(TNF) - a -like receptor su-perfamily . Therefore, this evidence evoked speculation that the locus may play an important role in determining the biological behavior of wild ~ type HCMV strains. However, no ligand for UL144 has been identified so far and its function is still unknown.Lurain et al showed an significant strain - specific sequence variability for UL144 by sequencing 45 low passage clinical isolates from solid organism graft and AIDS adults. Phylogenetic analysis indicated that the nucleotide and the a-mino acid sequences were divided into three groups, denoted group 1, group 2 and group 3, with group 1 showing three distinct subgroups A, B, and C. These results were subsequently confirmed by Bale et al. Their results suggested the UL144 genotypes did not correlated with the outcome of intrauterine HCMV infection, or with the development and severity of HCMV disease at birth. But Arav ~ Bogger et al showed their results contrasted with those of Bale and Lu-rain. In China, He Rong et al analyzed the sequencing results of 32 congenital CMV infection, the similar results as reported by Lurain. They indicated UL144 ORF might be related to tissue tropism and pathogenesis of HCMV infection.For further test the relationship between congenital CMV infection and distribution of HCMV UL144, UL139, and UL149 gene. About 300 samples with congenital and /or perinatal stage that were proved to contain HCMV DNA by fluorescent - quantified PCR ( FQ - PCR) method were amplified and se-quenced. We hope our report could establish molecular basis for revealing the function of UL144, UL139and UL149 protein and pathogenesis of congenialCMV infection.Materials and methodPatients and samples: About 300 clinical strains in urine were studied . All infants were congenital or perinatal CMV infection at < 3 months of age. They suffered respectively from jaundice, congenital megacolon (Hirschsprung's disease, HD) , purpura, spasm and so on.53 of the strains were selected from HD infants randomly. They were confirmed as colon narrow segment of HD infants by operation and pathologic diagnosis. Apart from 3 of 53 being entire colon type, 3 being long segment and 1 being short one, the remanent 46 cases were normal type. All cases were sporadic cases.DNA extraction:Primer design; Primers were designed by using software primer premier 5. 0 according to Toledo sequence, see table 1.Tablel : PCR primer pairs of UL139 ,UL144,and UL149 genePrimer Sequence 5' to 3' Position (Toledo) Length of productUL139 Ca CCAGAATGAAAGAGTATAATGTGCUL139Cb AAGCCTTAGCCTCTACGGTGTUL 139 Ca2 GTAAAACGATGCCGAATACAUL139 Cb2 GTGAAAGTGACGTCTCAGGUL144Ca TCGTATTACAAACCGCGGAGAGGATUL144Cb ACTCAGACACGGTTCCGTAAUL144Ca2 AGACACCGTTCGGCCCTATUL144Cb2 TTTAGTGCAGGAATTGGAAUL149Cal ACTCCTCTTCCTTCTGCTCUL149Cbl CCGACGTCTCGTACACTACUL 149Ca CTGGTCAAGACCAAGGAACAGUL149Cb TCTCGTACACTACCCGATACGUL149Ca2 CAACCGCCGGAGCAACCTUL149Cb2 GGACGCGAAACCCGGACTGAAPCR amplification: The condition for amplification with all primer sets were3724-37474220 -4440696bp3816-38344370-4388554bp7936 -79608674-8693738bp7961 -79798642-8660681bp15568 -1558616343 -16361775bp15706 -1572616338 -16357532bp15638 -1565516247 -16267609bp95X for 5min, followed by 30 cycles of 95X for 45 second, 54^ for lmin, and 72t for I min 30 second. This was followed by a single extension cycle of 12X1 for 10 min. PCR products were detected on a 1.5% agarose gel, stained by ethidium bromide. The bands containing the amplified fragments were visualized under UV illumination. DNA sequencing: PCR products were gel - purified using PCR fragment kit according to manufacture's instructions. And then se-quenced directly, using the same primer, with the BigDye Terminator Cycle Sequencing Kit. The sequencing products were analyzed on an ABI 3700 automated sequencer.Cloning: We cloned PCR products of UL144 gene from urine and intestinal specimens using Promega Company PGEM - T as vector and ml 3 + as standard primer.Sequncing analysis: Sequence analysis was performed by using programmes DNAclub,Bioedit,GeneDoc,DNAsis, and DNAstar.Nucleotide sequence accession numbers; The UL144, UL139 and UL149 open reading frames of clinical strains have been submitted to GeneBank by u-sing program Sequin.Microscope examStatistical Analysis: Descriptive statistics and analysis of proportions using chi square with SPSS software package. Only P values of < 0. 05 were considered significant.Results1. PCR amplification results(1) PCR amplification positive rate respectively was 93. 1% and 91.7% and 80.8% about L144,UL139 and UL149 gene.(2) Cloning result; No. 279 strain from urine has two genotypes. They are type II and type HI.2. Polymorphism of UL144 and UL139 and UL149 gene DNA and ammo acid sequences(1) Genotyping results about UL144 and UL139 and UL149The UL144 gene sequences of the 67 clinical strains studied clustered in four genotypes. They were respectively I A, I B, II and HI genotype. There was no I C, I A was predominant genotype.The UL139 gene sequences of the 80 clinical strains studied clustered in six genotypes. They were respectively designated as Gla,Gib, Glc,G2a, G2b and G3 genotype. G3 was predominant genotype.The UL149 gene sequences of the 63 clinical strains studied clustered in four genotypes. They were respectively designated as A, B, C, and D genotype. A and D gene were predominant genotypes.(2) The polymorphism of UL144, UL139 and UL149 gene DNA and amino acid sequenceThe length of UL144 ORFs is respectively 531 and 528 bases. They have the potential to encode 176 and 175 amino acid proteins.The length of UL139 ORFs is respectively 408, 420, 423,441 and 444 bases. They have the potential to encode 135 , 139, 140, 146 and 147 amino acid proteins.The length of UL149 ORF is respectively 369,372 and 375 bases. They have the potential to encode 122,123 and 124 amino acid proteins.Significant strain specific sequence variability was showed for UL144, UL139, and UL149 gene, with the majority of the variability changes in the 5' half of the gene. There are a lot of substitutions and insertions and deletions over their ORFs. At least 50% of the nucleotide substitutions are nonsynonymous.(3) The homology comparison UL144,UL139 , and UL149 with Toledo i-solate: Alignment comparison revealed that UL144 sequences of various clinical strains have 80.4% -99.4% of nucleotide and 79% ~ 100% of amino acid sequence homologies compared with those of Toledo, respectively. While UL139 gene has 87.7% -99.3% and 78.4% -100% , UL149 gene 93% -97% , and 87.7% -95.1% respectively on aspects of nucleotide and amino acid.(4) Relationship between UL144, UL139, and UL149 gene variability and clinical outcomes of HCMV infection: The group IA is predominant genotype for congenital malformation, HD, cholestatic hepatitis and extrahepatic biliary atre-sia. while Group Iff is main genotype for hematological system disease , nervoussystem disease, mild and asymptomatic infection in UL144 gene.The Group 3 of UL139 gene is a predominant genotype for 80 clinical strains. The strains in a kinds of congenital malformations, cholestatic hepatitis and hematological system disease are mainly Group 3 type, while the Group la is the predominant genotype for the strains of nervous system disease and mild HCMV infection. The strains of HD had no Group lc; EHBA and cholestatic hepatitis had no Group 2b; Group lb,Group lc and Group 2b are not in the strains of cholestatic hepatitis; Group 2 is not in that of EHBA; The strains in hematological system disease have no Group lb genotype; The strains of nervous system disease are absent from Group 2a and Group lc; There are no Group 2a and Group lc in mild and asymptomatic HCMV infection.Among UL149 genes, 63 of clinical strains are found in A and D genotypes predominantly. The strains of HD are mainly genotype A and D, and no gene-type C. The strains of cholestatic hepatitis and EHBA are distributed all kinds of genotypes evenly. The Group A genotype has only in the strains of hematological system disease, but no in that of neverous system disease. Three of strains about multisystem HCMV infection are distributed in Group B. Asymptomatic or mild CMV infectious strains have no Group C.2. Analysis of posttranslational modification sites of UL144, UL139, and UL149 protein(1) Analysis of posttranslational modification sites of UL144The analysis of protein motifs showed that the tumor necrosis factor receptor (TNFR) , N - glycosylation site and protein kinase C phosphory action site (PKC) on the C end are conserved in UL144 encoded protein of all clinical strains. While there is a specific Acyl carrier protein ( ACP) site and absent of a myristoylation site(MYR) in strains of Group Id compared with those of other two group. A MYR sites is added respectively at 19 amino acid( aa) and 53aa sites in strains of Group II.There are associations between UL144 motifs and various disease. The strains of HD lost a site at 49aa ~51aa locus. A ACP site is deleted, but MYR site at 49aa ~51aa is highly conserved for the strains of cholestatic hepatitis.(2) Analysis of posttranslational modification sites of UL139Posttranslational modification sites in UL139 encoded protein are ASN, CKP, MYR, PKC and ACP sites. These sites are distributed sporadically over the whole aa sequences. The important functional motifs on the 3'end and 5'end are highly conserved. There are insertion, deletion and addition for CPK, ASN, ACP, and MYR sites between 33aa and 51aa of Toledo isolate. ACP site and CKP site at 48 aa locus are deleted in the strains of HD, cholestatic hepatitis and nervous system disease.(3) Analysis of posttranslational modification sites of UL149There are CKP, cAMP, PKC, TYR and AMI functional sites in UL149 encoded protein. The PKC site of all strains is highly conserved. The strains of Group B lost CKP site at 27 aa locus. All of strains except No. 88 strain are highly conserved in cAMP motif. 9 strains in genotype A add a TYR site between 62aa and 70aa. The PKC, AMI and cAMP sites are highly conserved in the strains of HD. CKP site of the other clinical strains of HD except llm and 14m one is also highly conserved. 5 of HD strains have TYR site. AMI, PKC and cAMP site are highly conserved for the 14 strains of cholestatic hepatitis and EHBA. 3 of EHBA strains lost CKC site. The strains of hematological system disease are highly conserved in CKP, AMI, PKC and cAMP motifs. Apart from three strains, all of strains in mild outcomes and nervous system disease are highly conserved on the above four functional motifs. The three clinical strains of multisystem CMV infection lost CKP site. In addition to the strains of nerve system disease, The TYR site is possessed by the strains of other disease.3. Predicted properties of UL144, UL139 and UL149 protein(1) Predicted properties of UL144 proteinMolecular mass of UL144 protein is predicted as 19.6-19.9KD, approximately. The pi is 8.53 ~8.68, indicating that it is an alkaline protein with positive charge.(2). Predicted properties of UL139 protein1). Molecular mass of UL139 protein is predicted as 14.2 ~ 15.3KD, approximately. The pi is 4.94 ~5.64, indicating that it is a weakly acidic protein with negative charge.2). The predicted secondary structure of UL139 encoded protein is clus-...