Sequence Variability Of Human Cytomegalovirus UL144,UL146 And UL147 Genes

ObjectiveHuman cytomegalovirus ( HCMV) infects a majority of the population by early adulthood. Although generally asymptomatic in immunocompetent individuals , HCMV infection remains the most important congenital disease as well as a major problem in immunocompromised patients. Congenitally acquired HCMV infection can lead to jaundice, hepatitis syndrome, megacolon, microcephaly, and so on. HCMV is also associated with exacerbation of vascular disease, particularly after solid organ transplantation.HCMV is a genetically complicated virus, its genome consists of 230 235 kbp of double - stranded DNA and more than 200 predicted open reading frames ( ORFs) . HCMV infects a number of organs and cell types in vivo. Each clinical isolate has the potential for a unique identity, which leads to the hypothesis that strain variation affects the outcome of HCMV infection. A new region of DNA containing at least 19 ORFs (denoted UL133 - 151) was found in the low - passage HCMV clinical strain Toledo and several other low - passage clinical isolates. This region, however, is not present in the HCMV laboratory strain AD 169. These new ORFs and their predicted products may be essential for viral infection in vivo. Two of these genes, UL146 and UL147, encode proteins with sequence characteristics of CXC (a) chemokines, suggesting that they influence the behavior of neutrophils during infection. HCMV UL144, a region that encodes a homologue of the herpes simplex virus entry mediator~2, a member of the tumor necrosis factor receptor ( TNFR) supeifamily contribute to the ability of HCMV to escape immune cleaning . Considerable sequence divergence has beenobserved in UL144, UL146 and UL147 of clinical isolates from transplant recipients. But nearly all of HCMV isolates used in these studies to date were derived from persons immunocompromised by AIDS or transplantation. It is unknown whether the genetic variability observed among such strains adequately reflects the variability of HCMV strains circulating among HCMV - infected children and immunocompetent persons in the general population. In this report, we describe the sequence variability for UL144>UL146 and UL147 sequence among wild -type HCMV strains isolated from suspected congenitally infected infants and young children attending group childcare, a major community reservoir of HCMV.Materials and MethodsPatients and SpecimensSixty - five isolates and seven urine samples from suspected congenitally HCMV - infected children were studied. Isolates were from the patients suffered from jaundice (n =43) , megacolon (n =9) and microcephaly (n = 13) respectively. Urine samples were from asymptomatic infants. All HCMV infections were confirmed by positive results of virus isolation or fluorescent - quantified PCR test for HCMV. Infants with suspected congenital infection were from the 2nd Clinical Hospital of China Medical University, asymptomatic infants were from the Day Care Center at Shenyang. All samples were collected with permission of the infants'parents.Samples of urine and abnormal colon tissue were collected for HCMV isolation in the 1980s. Virus isolates were propagated < 10 times in human embryonic lung fibroblasts (HELF) in Eagles minimum essential medium supplemented with 10% fetal bovine serum. The isolates were kept at 70 until use. Urine samples from 7 asymptomatic infants were used directly for PCR amplification.PCR AmplificationA fragment (9,366 10,845 of Toledo) including UL146 and UL147 ORFs and was amplified by nested PCR or heminested PCR. Taq DNA polymerase was used for PCR amplification. Primers used in the study were designed based onthe sequence of Toledo strain (GenBank accession No. U33331) , using Primer Premier 5.0 software. Forward and reverse primers were used for first - round PCR amplification, yielding products of 1,304 and 1,698 bp, respectively. Several sets of nested primers were used for detection of UL146 and UL147 in the cultured fluid and the urine samples when the product of the first - round amplification was either negative or weak. A 737 bp product of the complete UL144 coding sequence was amplified with the primer pair designated UL144 -B' A 355 bp product of the variable UL144 coding sequence was amplified with the primer pair designated UL144 - A, which was designed based on the sequence of Toledo strain (GenBank accession NO. U33331) using Primer Premier 5.0.TABLE 1. Primeres Used to PCR Amplify UL144^UL146 and UL147 sequencesPrimersequencePosition (Toledo)UL144G2UPUL144G2downUL144G3upUL144G3downUL144upUL144downUL144VabupUL146upUL146downUL146NdownUL147upUL147downUL147NupUL147Ndown5' AAGTGTGTACAGAGAATAGTGGCAT3'5' ACCCACGAGAAAGATGAAGAG3'5 TGCTGAGTATGCTATTGGCATGCAT3'5 'TACGGTGTTATTAGTGGAAGTG3'5 'TCGTATTACAAACCGCGGAGAGGAT3'5 'ACTCAGACACGGTTCCGTAA3'5 'TCGTATTACAAACCGCGGAGAGGAT3'UL144Vabdown 5 'TACGGTGTTATTAGTGGAAGTG 3'5 'CGCAGTTTTGAGCGATTT3'5'CCAGCAGGACGAGCGTGAA 3'5 'TTGGTTCCCTTGTCCTTT3'5' ATCACCAGGACCGAGACGAAT3'5 'CGGTGACAGGGTGTATCGT 3'5' AGCTGCAATCGTCAGGAAG3'5 TCGGTAGACCAGAAGGGCG3'814584438034829079358673793582909376106791014197521144910093108452. The conditions for amplification with all primer sets were 95° for 4 min, followed by 35 cycles at 94 for 45 s, 55 for 1 min, and 72 for 1 min, and a single extension cycle of 72 for 10 min. Amplicons were visualized on 1.5% agar-ose gels with a DNA mass ladder.3. Combined heteroduplex/single strand conformational polymorphism assayAll positive samples amplified by primer A were analyzed by heteroduplex mobility assay and single - stranded conformation polymorphism ( HMA - SS-CP). Equivalent amounts of target and driver DNA were mixed. Mixed PCR products were denatured at 951 for 10 minutes and then were snap cooled on ice. The resulting heteroduplexes and homoduplexes were subjected to electro-phoresis in an 8% poryacrylamide gel at 350W over 3-4 hours. DNA was stained with 0.2% silver nitrate.4. DNA PurificationUL144^UL146 and UL147 amplicons were purified for sequencing by recovering from a 1 % agarose gel slice in 1 x TAE buffer using Wizard SV gel and PCR Clean - Up System, according to the manufacturer' s instruction ( Pro-mega) . Purified fragments were eluted in 50 |xl of nuclease - free water.5. DNA SequencingConcentrated PCR products were sequenced directly using the same primers as in PCR with BigDye Terminators Cycle Sequencing Kit. Sequencing was usually carried out on both DNA strands. The sequencing reactions were performed with a PE Applied Biosystems Geneamp PCR System 2400 at 96 for 10 s, 50 for 5 s, and 60 for 4 min for a total of 30 cycles. The sequencing products were analyzed on an ABI 3700 automated sequencer.6. Sequence AnalysisSequence chromatograms were analyzed with Chromas program. All nucleo-tide and amino acid sequence analyses were performed using BioEdit Version 5. 0.0 and DNA STAR Version 5. 1. Identity scores were obtained by performing pairwise alignments of sequences with MegAlign. The ClustalW algorithm was used to align multiple sequences of nucleotide and predicted amino acid. Phylo-genetic tree was performed using DNASTAR. The post - translational modifica-? 13-tions of predicted protein were identified with the NCBIPROS database.7. Nucleotide Sequence Accession NumbersThe UL146 and UL147 sequences of the clinical strains have been assigned GenBank accession Nos. AY788113 AY788135, AY788137 AY788146 and AY366449 AY366461, respectively. The UL144 sequences of the clinical isolates have been assigned GenBank accession no. AF382014 - AF382031, AF447377 - AF447390.8. Statistical AnalysisThe significance of the linkage between UL146 and UL144 genotypes was analyzed by use of Spearman s method (SPSS software). Only p values of <0. 05 were considered significant.ResultsPresence and groups of complete UL144 ORF in congenitally infected and asymptomatic children PCR results showed that 60 of 72 isolates bored the positive amplification results with primer B, including 5 from asymptomaticly infected children. Twelve samples were negative by primer B, but" positive by QPCR.Heteroduplex mobility analysis of genotypically heterogonous products revealed three kinds of band pattern, designed as type 1 ( n = 27 ) , type 2 ( n = 14 ), type 3 ( n = 17 ) , but two isolates showed specific band pattern both of type 2 and type 3.DNA sequencing and phylogenetic analysis of 32 sequences showed that UL144 sequence were hypervariability ( Fig 2 ). All these sequences can be divided into three groups and five subgroups, referred to as " 1A" (n = 11 samples, 34%), "lB"(n=2, 6%), M1C" (n = l, 3%) , "2" (n =5,16% ) and "3"(n = 13, 41%). Sequences in group 1 were either identical or very similar to that of Toledo. Strains in group 2 and group 3, have 73 -74 and over 100 nu-cleotides difference relative to Toledo, respectively. All these mutations were concentrated in the 5'half of the gene. Isolate 51C of group 1A had three nucle-otides deletion at position 327. Isolate 9J of group 2 had three nucleotides absence at position 345 and nine nucleotides absence at position 390 nt.. 14 .Amino acid sequence and structural analysis of the predicted UL144 encoded proteinThe large number of amino acid substitutions found in the sequence of strains of the different UL144 sequence groups. There were less than 10 amino acid substitutions in group 1 relative to Toledo, and from 28 to 35 substitutions in the other two groups.The results of function identified showed that the important functional consensus , such as TNFR (tumor necrosis factor receptor) site, N Glycosylation site, and Transmembrane site were highly conserved of UL144 clinical isolates. While there were a specific Acyl Carrier Protein site and absent of a Myresayl site in strains of group 3 compared with those in the other two groups. Isolate 9J in group 2 lost a myristayl site and a Protein Kinase C Phosphorylation site for its deletions of nucleotides at corresponding position.The predicted secondary structure of UL144 encoded protein showed that all 32 clinical isolates formed 6 types of secondary structure. Strains in group 1A, IB,2 and most of 3 formed I to IV type of secondary structure for their special protein characteristics. Isolate 23J in group 1C and all strains in group 2 were similar at the N terminal end of protein sequence, formed type V of secondary structure. Four strains of group 3 had an amino acid mutation at position 103 aa, formed the special type VI of secondary structure.Variability of UL146 ORF in Clinical StrainsThe UL146 ORF of strains from suspected congenitally HCMV - infected infants were hypervariable. The length of UL146 ORF in studied strains was from 345 to 378 base pairs, except for isolate 33J that had only 162 base pairs because of frame - shift by two nucleotides deletion at 70 nt and 145 nt position respectively. Phylogenetic analysis showed that all of the UL146 sequences including Toledo were divided into 3 major groups and 5 subgroups, designated G1A, GIB, G2A, G2B and G3, respectively. The majority of strains (17 or 25.68% ) were distributed in G2. No sequence was exactly identical to Toledo, although the UL146 sequences in G1A (n = 6) showed more than 99% identity to Toledo. The sequence in GIB (n = 1) had 76% identity to Toledo. Sequences in G2 (n = 17) were significantly divergent from Toledo, with the i-dentity of lower than 52% , especially for isolate 33J, which had only 23. 7% sequence identity. There was only one isolate (16 M) in G3, which had less than 50% identity to not only Toledo but also all the other sequences.Amino Acid Sequence and Structural Analysis of the Predicted UL146 ProteinThe nucleotide polymorphisms conferred substantial amino acid substitutions when compared with Toledo, especially for strains in G2 and G3 (less than 40% identity). Only the strains of GIA had sequences similar to Toledo (more than 97% identity).There was a conserved ELRCXC ( CXC ) chemokine motif existing in almost all sequences in spite of the high sequence variation. Like in Toledo the a chemokine motif, ELRCRC was found in all sequences in GIA and 2 sequences in G2B ( n = 8 ). like in Towne, ELRCPC motif was found in 14 sequences in G2. The chemokine motif ELRCKC was found in all sequences of GIB. There were 2 sequences that did not maintain the ELRCXC motif. One was isolate 16 M in G3, which had a NGRCTC motif instead. The other one was isolate 33J in G2 A, which lost CXC motif due to frame - shift.The prediction of post - translational modifications by NCBIPROS database showed that there were three glycosylation sites in the sequence of Gl, but only one site in all sequences in G3 and 2 sequences in G2.Linkage of UL146 and UL144 Sequence GenotypesBesides UL146, we found that UL144 ( GenBank accession Nos. AF382014 AF382031, AF447377 AF447390) ORF can also be divided into different genotypes. There was overlap with 17 strains, including Toledo, se-quenced for both of the ORFs (table 2). The observation that all UL146 G2a i-solates (n = 4) were UL144 G3, 5 of 8 UL146 G2b isolates were UL144 Gla, and that, conversely, 5 of 7 UL144 Gla isolates were UL146 G2b, suggested a possible linkage between UL146 and UL144 genotype. A homogeneity test of the association between two genes revealed a significant association ( p < 0. 05 ) a-mong these variants.Sequence Variability of UL147 ORF in Clinical Strains25 sequences from children with suspected congenital HCMV infection werestudied. Although all sequences of UL147 had more than 90% identity to that of Toledo, but none was completely identical to it.The length of UL147 predicted protein in clinical strains ranged from 157 to 160 amino acids. Not so many amino acid substitutions were found in UL147 sequences as those in UL146. All amino acid sequences of UL147 in clinical strains were more than 86% identical to that of Toledo.There was a conserved CRC (CXC) chemokine motif existing in all UL147 sequences. The prediction of post - translational modifications by NCBIPROS database showed that there were two new important modification sites, CK2 phosphorylation site and PKC phosphorylation site, in almost all UL147 predicted proteins.ConclusionsHCMV - UL144^UL146^UL147 existed in most of low passage isolates and sequences were hypervariable. UL146 gene is the most variable region in HCMV. Sequence variability among HCMV clinical, strains may affect its ability to attract human neutrophils and influence viral disseminationConservation of the chemokine and the TNFR motif in UL146 ^ UL147 and UL144 putative protein implies that these gene region has biologic importance for HCMV infection.A significant linkage was found between UL146 and UL144 sequence genotype.It is a feasible method to detect the variability of genes by HMA - SSCP.