ObjectivePercutaneous coronary intervention ( PCI) is now one of widely used methods to treat coronary artery disease, but restenosis following PCI, which occurs in 30 - 40% of patients undergoing this procedure, limits its long - term benefits. The biological mechanisms are complex, involving elastic recoil in the first instance, followed by extracellular maxtrix production, smooth muscle cell proliferation and migration, and remoding of the vessel. Although silorimus - elu-ting stents might suppress restenosis, its benefits have not yet been completely established. Therefore the hunt for efficient inhibitors of restenosis remains an ongoing challenge. Deoxyribozyme (DRz) is a DNA molecule with the activity of enzyme catalysis ( DNAenzyme) , which has practical therapeutic implications as a new category of gene - inhibitor. Early growth response factor - 1 ( Egr -1) is a zinc finger structural factor that is activated under the outside stimulation of arterial injury leading to the splitting, migration and proliferation of vascular smooth muscle cell ( VSMC) and neointimal hyperplasia. The aim of this study was to generate a novel DNAenzyme targeting Egr - 1 (10-23 DRz, ED5) and observe the effect of ED5 on endothelial celluar function of injured artery, phe-notype of VSMC and neointimal hyperplasia after ballon injury, and to primarily study its mechanism of inhibiting neointimal hyperplasia.Materials and methods1. Synthesis of ED5ED5 was synthesized by Shanghai Bioasia and the base sequence was: 5' -CCGCTGCCAGGCTAGCTACAACGACCCGGACGT - 3'. ED5 was modified by thioxo at the 3' end and 5' end, and was labeled with fluorescein isothiocyanate ( FITC) at the 5'end to observe the distribution of genes after transfection under fluorescence microscope.2. Establishment of rat carotid injury model and experimental groupingThe present experiments were reviewed and approved by the Committee on Ethics on Animal Experiments, China Medical University, according to the Guidelines of the American Physiologic Society. This study was performed at China Medical University.Ninety - six Wistar male rats weighing 350 - 400g ( Provided by China Medical University) were randomly divided into four groups: the sham - group, the MgCl2 group (the simple injury group) , the FuGene6 - group ( vacant transfection reagent group) and ED5 + FuGene6 - group ( n = 24 ). The sham -group, the MgCl2 group and the FuGene6 - group served as control groups.Ninety - six Wistar male rats were anesthetized with 10% hydronaldehyde (300mg/kg) . The rats were cut in the middle of the neck and the left common and external carotid were exposed and stopped from the bleeding at near or distal end by the serrefine. A 2 - french Fogarty balloon catheter ( Baxter Healthcare Corporation) was introduced through an arteriotomy to the external carotid, advanced into the common carotid, inflated to generate resistance and withdrew three times in a manner that had been described. After removal of the catheter, a 200 |xl solution (at A°C ) containing FITC -labeled ED5 500 |ig, transfection reagent FuGene6 30 jjj and 170|xl lmM MgCl2 was injected locally into injured vascular subsection for 20 minutes in ED5 + FuGene6 - group. The intimal de-nudeation and green fluorescent excited by 470 - 490 tun optical could be seen in the intimal and medial layers on the 24th hour after delivery of FITC labeled DNA enzyme ( ED5 ) by the fluorescence microscope. A 200|xl solution ( at 4*C ) containing transfection reagent FuGene6 30 jxl and 170jxl lmM MgCl2 was injected locally into injured vascular subsection and incubated for 20 minutes in the FuGene6 - group. 200 jxl lmM MgCl2 was injected locally into injured vascular subsection for 20 minutes in the MgCl2 group. The sham group was onlytied with a ligature at the carotid artery without the insertion of catheter, then external carotid artery was tied with a ligature to resume blood stream and the cut was sutured at the neck. After operation, penicillin was used locally to prevent infection, the rats were fed standard food and free water.Six rats were killed in each group on the 3rd, 7th, 14th and 21st day after operation and the blood was sampled from the heart for use before killing. The injured vascular subsections were harvested and used for the determination of he-matoxylin and eosin staining, transmission electron microscope ( TEM ) , immu-nohistochemistry, Western blot and RT - PCR.3. Agent and PrimerDetermination of the serum level of nitric oxide ( NO) , nitric oxide syn-thase (NOS) and endothelin (ET) concentration was made respectively by nitric reductase, chemical colorimetry and radioimmunoassay ( RIA). The kits were bought respectively from Nanjing Juli Biomedical Engineering Corporation and Beijing Dongya Immunotechnology Corporation.The all working concentration of Egr - 1 polyclonal antibody ( Santa Cruz Biotechnology) , PCNA and TGF - (3j monoclonal antibody ( Boster Biotechnology) for immunohistocHemistry was 1 : 100. All diluted strength of three antibodies above - mentioned were 1 : 300 for Western blot. Total vascular tissue RNA was extracted by using RNAout one - step method ( Huass Biotechnology). The reverse transcription reaction was carried out in accordance with the standard description in the reverse transcription kit (from TaKaRa). The reaction conditions were;30X110 min, 45t 30 min, 99T! 5 min and 5X110 min. The primers of Egr - 1 ? PCNA ? TGF - (3, in PCR and (3 - actin were designed and synthesized by TaKaRa.Egr -1 upstream: 5' - CAGTCGTAGTGACCACCTTACCA - 3',downstream: 5' - AGGTTGCTGTCATGTCTGAAAGAC - 3';PCNA upstream: 5' - GGGGTGAAGTTTTCTGCGAG - 3',downstream: 5' - CGATCTTGGGAGCCAAATAATAC - 3';TGF - p, upstream: 5' - CTGAACCAAGGAGACGGAATACA - 3', downstream: 5' - CAAAGCCTGCGGCACG - 3';p - actin upstream: 5' - GTGGGCCGCTCAAGGCACCAA - 3',downstream: 5' -CTTTAGCACGCACTGTAGTTTCTC -3'.Amplification fragments were Egr - 1 449bp, PCNA 271bp, TGF - Pj462 bp and p - actin 400 bp respectively. The results were analyzed by gel imaging analyzer(Flourchen V2. 0 Stand Alone). Each sample of Egr - 1, PCNA and TGF - Pi amplification straps was used as relative value of Egr - 1, PCNA and TGF - Pj contents together with that of integrated density value of inner reference P - actin.4. Statistical analysisAll the data were analyzed using SPSS 11. 5 software package for statistical analysis. Data were expressed as the mean ± standard deviation. Group comparison was done using analysis of One - Way ANOVA. A P - value of less than 0. 05 (p <0.05) was considered to be statistically significant.Result1. Serum NO, NOS and plasma ET levelsCompared with two control groups, the serum levels of NO and NOS in ED5 + FuGene6 - group were higher ( p <0. 05);but the level of ET in ED5 + Fu-Gene6 - group was lower than that in two control groups ( p <0.05 ).2. Pathological and morphological changes of blood vessel after the rat arter-y balloon injuryIn the sham group the artery intima in rats remains intact. The arterial inti-mal thickening existed on the 7 th day in the arteries of the MgCl2 group and the FuGene6 - group, but it was not significant in ED5 + FuGene6 - group. And it was more significant on the 14th and 21st day. In arteries treated with ED5, the intimal hyperplasia decreased.The result observed by TEM: the smooth muscle cell (SMC) shows contractile type and shuttle nucleus with cytoplast containing myofilament in the sham - group. The VSMC of neointima in the MgCl2 group and the FuGene6 -group shows synthetic type, SMC cytoplast becomes bigger, nucleus increases remarkably with more mitochondria and golgiosome in the cytoplasm with less myofilament. but VSMC of neointima in FuGene6 + ED5 - group may be con-tractile type, the cytoplast and nucleus of VSMC are smaller with relatively more myofilament and less mitochondria and golgiosome in the cytoplasm.3. ImmunohistochemistryIn the artery wall of the sham - group, the expression of Egr -1 and PCNA was negative, the expression of TGF - ($iwas weakly positive. But brown yellow particle appeared and largely distributed in the cytoplasm and karyon of media and incrassated intima cells on the 3rd, 7th, 14th, 21st days after balloon injury. Compared with control groups, the positive degree was obviously decreased in ED5 + FuGene6 - group( P <0.001).4. The result of Egr -1, PCNA and TGF - (3, protein by Western blot analysisThere was no protein band of PCNA in the sham group;the grayness of Egr -1 protein band gradually increased on the 3rd, 7th, 14th and 21st day after balloon injury. PCNA reached its peak on the 7th day, TGF - [3, reached its peak on the 14th day. Compared with two control — groups, the expression of Egr - 1, PCNA and TGF - pj protein reduced at every time point in ED5 + Fu-Gene6 - group ( p < 0.01).5. Expressions of Egr - 1, PCNA and TGF - 3, mRNAThere was little Egr - 1 and TGF - 31 mRNA expression in the sham group, while no expression of PCNA mRNA. The expression level of Egr - 1, PCNA, TGF - p,mRNA increased gradually after balloon injury. The expression of Egr -1 mRNA increased obviously and persisted. The expression of PCNA mRNA reached its peak on the 3rd day and begun to decrease on the 7th day after balloon injury. The expression of TGF - 31 mRNA reached its peak on the 7th day and begun to decrease on the 14th day. Compared with two control - groups, the expression level of Egr -1, PCNA, TGF - 3xmRNA in ED5 + FuGene6 - group reduced at every time point (p <0.001).DiscussionEgr -1 is an immediate — early gene product, a zinc - finger transcription factor and a kind of DNA - bindind protein that interacts with a consensus GC -rich region. For a number of reasons, Egr -1 seems to offer an ideal target for therapeutic intervention to block restenosis. First, Egr -1 is poorly expressed in the uninjured artery wall but rapidly upregulated by mechanical injury. Second, Egr - 1 controls the expression of a large number of genes whose products are implicated in development of vascular lessions and associated complication - factors that modulate migration, proliferation, extracellular maxtrix production, intercellular adhesion, and thrombosis. Third, besides injury, Egr- 1 is activated by multiple external stimuli including growth factors and cytokines, hypoxia, physical forces, injurious stimuli, etc. It may contribute to the pathogenesis of atherosclerotic and postangioplasty restenotic lesions. These diverse influences may affect vascular remodeling and hyperplasia in atherogenesis, restenosis, hypertension, and ischemia reperfusion. Finally, Egr - 1 and a large number of Egr -1 - dependent genes have recently been detected in human atherosclerotic lesions. DRz is a kind of DNA molecule with enzymatic activity. ED5 is one of 10-23 DRz family, which has phosphoesterase activity, and the bilateral substrate recognition sequence of ED5 can be specifically combined with that of RNA. Relative to the substrate of catalytic structure domain in the RNA chain, a specific phosphodiesterase incision site formed in order to cut the substrate RNA between catalytic sequence unpaired purine and paired pyrimidine residue. In this study, we synthesized ED5 with the activity of enzyme catalysis and transferred into the balloon injury artery wall. The result demonstrated that ED5 inhibited the expression of Egr - 1 protein and mRNA, at the same time we observed that ED5 lessened the thickening of neointima, and further demonstrated the effectivity of ED5.To research the other factors influencing neointima hyperplasia, we detected all important indicators reflecting endodermis secretion. NO is a kind of cy-tokine with many biologic activities. At physical state, it can dilate blood vessel , increase volume of blood flow, inhibit the expression of vascular endothelial cellular adhesion molecule, inhibit the formation of mural thrombosis by inhibiting platelet aggregating, inhibit inflammatory reaction of vessel wall by inhibiting the activation of WBC adhesion, and inhibit the formation and thickening of neointima by inhibiting SMC division and proliferation that promote VSMC apop-tosis. NOS is the rate - limiting enzyme on NO synthesis, in the role of which, L-2 - amino -5 - guanidinovaleric acid and dioxygen reacts, NO is released by removing L - carbo - ammine acid. So far, ET is the strongest vasoactive peptide for blood vessel contraction, and at the same time it has a stronger activity like growth factor to promote VSMC proliferation by autocrine or paracrine secretion. Study found that vascular endothelial cell damage resulted in the destruction of large amount of NOS, the decrease of NO and also the release increase of ET. Experiment found that though the level of ET in ED5 + FuGene6- group was lower than that in two control groups, while still higher than in the sham - group due to the release of ET and secret by neointima after balloon injury, so it is easy to undersdand. Experiment also found that ED5 could increase the release of NO and NOS after the injury of blood vessel. The notion of the increase of NO and NOS agreed with that of the release of NO by NOS catalytic L- 2 - amino - 5 - guanidinovaleric acid synthesis. Furthermore, in the ED5 + FuGene6 - group and two control groups, it had more release of NOS than that in the sham group after blood vessel injury. So a compensatory mechanism was considered to keep the tension of the injured blood vessel and to decrease the thrombosis. Hence, the effect of ED5 on the vascular endothelial cell might be considered as that it indirectly plays a role in improving the vascular endothelial cell by inhibiting the synthesis of Egr - 1 protein.References reported that proliferation and migration of SMC plays an important role in the restenosis after vascular injury. The result of study indicated that there was some thickening in intima and narrowing in lumens after vascular injury. TEM found that the smooth muscle cell in normal arterial blood vessel showed contracted type and the caryon showed Fusiform shape, there was a lot of actin filament in the cytoplasm and a little of mitochondria at both sides of the nucleus. SMC cell body showed synthetic type after balloon injury, became larger and caryon increased, there were much mitochondria and golgiosome in en-dochylema with actin filament decreased. In ED5 + FuGene6 - group, the body of SMC cell closed to contracted type and its caryon was small, there was relatively more actin filament, less mitochondria and golgiosome at both sides of the nucleus. It is shown that ED5 can influence the phenotype transform of VSMC,inhibit smooth muscle overgrowth and intima proliferation by inhibiting Egr - 1 synthesis, thus it made the intima to grow less after vascular injury.Proliferating cell nuclear antigen (PCNA) or cyclin is a kind of acid nuclear protein related to the cell multiplication. PCNA, as auxiliary protein of DNA pclymerase 8, is necessary for DNA replication. The increase of PCNA intronu-clear expression means the entry of DNA synthesis ( S phase) or DNA presyn-thetic phase ( G, phase) , but in the metabolic stage ( Go phase) , PCNA does not express. So the expression of PCNA is the mechanism of cell multiplication and also a reliable indicator reflecting cell multiplication. The study showed that in normal intima and media there was no expression of PCNA, which increased after the injury of intima and decreased after the treatment with ED5. It was considered that Egr - 1 might participate in the control of PCNA expression, and it might be related to the synthesis and package of PCNA protein.It is proved that TGF - p, is a kind of cytokine existing in the body widely. TGF - p, promotes the endothelial cell regeneration, the vascular growth as well as smooth muscle cell hyperplasy. It also promotes the formation of extracellular matrix and inhibits the decomposition of extracellular matrix. In the study of vascular balloon injury in rats, it is found that the high expression of TGF - p, mR-NA can last 2 weeks or longer. The formation of neointima can be inhibited by the TGF - (3, antibody. Chamberlain et aldiscovered that the activity of TGF - p in the proliferative intima enhanced after PTCA. All these show that TGF - (3 plays a vital role in the formation of restenosis. Study also found that high expression of TGF - Pi reached its peak on the 14th day after vascular balloon injury in rats. The decrease of the expression of TGF - Pj after the treatment with ED5 may be related to Egr - 1, which control the expression of many downstream genes in relation to the formation of angiostegnosis, for example the expression of TGF - Pj. ED5 decreases the expression of TGF - p, with the decrease of the expression of Egr - 1.Experimental results show that ED5 gene transfection may improve artery endothelial function after carotid artery injury, can stabilize the phenotype of VSMC, and inhibit neointimal hyperplasia by specially suppressing the expression of corresponding genes after balloon angioplasty.Conclusion1. ED5 gene transfection may improve artery endothelial function by decreasing the plasma level of ET and increasing the serum levels NO and NOS after artery injury.2. ED5 gene transfection may specially suppress the expression of Egr - 1 and corresponding genes with Egr - 1 , inhibit the phenotype transform of VSMC at the side of vascular endothelial injury and have the role of inhibiting neointi-mal hyperplasia after balloon angioplasty.
|