Regulation Of OxyR To Oxidative Damage In Yersinia Pestis | | Posted on:2008-05-13 | Degree:Doctor | Type:Dissertation | | Country:China | Candidate:Y F Qiu | Full Text:PDF | | GTID:1104360212497663 | Subject:Prevention of Veterinary Medicine | | Abstract/Summary: | PDF Full Text Request | | Plague has ravaged human populations for many centuries and claimed hundred millions of lives. Plague normally cycles between fleas and rodent hosts, with humans providing an unproductive alternative. Yersinia pestis is the etiologic agent of plague. Its growth and proliferation of within the macrophage cell upon early-stage entry of host is considered as a key step for further infection and pathogenesis. Since Y. pestis undergoes various types of environmental changes during transmission and infection,a wide range of rapid, adaptive responses to the changing niches are required. In response to these stresses, bacteria can activate or repress the transcription of a specific set of genes whose products play roles in coping with a given physico-chemical stress or whose transcription was inhibited by specific environmental and cellular signals.Firstly,We successfully constructed Y. pestis ?oxyR mutants by one-step mutantion technique. And then,In order to test the relationship between OxyR and resistantance against hydrogen peroxide,we design some phenotype experiment including hydrogen peroxide diffusion assay and hydrogen peroxide adaptiion assay between Y. pestis wild strain and ?oxyR mutants ,the result that ?oxyR mutants is more sensitive than wild strain to hydrogen peroxide strongly validated OxyR is directly related to resistantance against hydrogen peroxide in Y. pestis and the result of hydrogen peroxide adapation assay that wild strain pretreated by low concentration hydrogen peroxide appear more resistant to hydrogen peroxide than ?oxyR mutants likewise validate the above conclusion .Macrophage phagocytosis assay result show that although there is not difference in the percentage of cell-associated bacteria between Y. pestis wild strain and ?oxyR mutants , the difference of the percentage of phagocytosis between them is marked.This result show OxyR might have resistant action in the course of phagocytosis,but not adhension.Here Y. pestis whole-genome DNA microarray was used to investigate global transcriptional responses when wild-type Y. pestis was grown in chemically defined medium with low concentration of hydrogen peroxide stresses in vitro environment. In addition one Y. pestis mutants of global regulator (OxyR) were exposed to specific stress to respectively examine the possible regulated genes. All data on transcriptional changes of all 4,005 genes anchoring on Y. pestis genome microarray was collected and the cluster analysis was performed based on gene class.The result of comparative transcriptome of hydrogen peroxide stimulon that the classes of changed genes in expression mainly were included DNA repair system, Osmolarity-associated proteins and detoxifier of H2O2 suggest these classes exert main performance in resistance to hydrogen peroxide. The analysis of oxyR regulon transcriptome show OxyR exert resistance to oxative stress in Y. pestis by regulate the level of transcription of oxyR regulon.In this study, Molecular biochemistry assays, including electrophoretic mobility shift assays (EMSA), DNaseI footprinting and primer extension assay, were employed to identify genes which are directly controlled by OxyR. Above all, we identified 14 genes directly controlled by OxyR based on EMSA. These genes which were selected by the analysis of transcriptome and bioinformatics were either repressed or activated by OxyR. Then ,We use DNaseI footprinting assay to validate the location and target DNA sequence of two genes (katA gene encoding calalase and katY gene encoding catalase-peroxidase) which were directly controlled by OxyR by EMSA and comfirmed by some articles. The results show the target DNA sequence (binding box)of katA gene is GATTACCCATGTTAACAATAAGGCATACCTATTTGC, and the target DNA sequence (binding box)of katA gene is TAGGACTAACGAATTG.. Primer extension assay show the transcription start site of two genes is adenine A which lie between the first codon and OxyR binding region.All data in this study are helpful to further understand the mechanism that Y. pestis resist oxidative stress and interaction between macrophage and Y. pestis. | | Keywords/Search Tags: | Y. pestis, OxyR protein, regulon stimulon, EMSA, DNaseI footprinting, primer extension assay | PDF Full Text Request | Related items |
| |
|