The Study Of Relationships Between Anger Emotion Trait And Neurotransmitter Metabolic Enzymes Genetic Polymorphisms

Objective:This paper attempts to investigate the relationships between anger emotion trait and neurotransmitter metabolic enzymes genetic polymorphisms, and analyze correlations among the dimensions of anger emotion trait。Methods:1. STAXI-2 questionnaire inquirySubjects are normal college students who come from Henan University of Traditional Chinese Medicine. After the ethics committee approved and signed the informed consent forms, we use cluster random sampling method to collect survey samples. A total of 2864 questionnaires were issued, in which 2642 questionnaires were valid, accounting for 92.25%. According to the trait anger scale, We define scores> x+s as the high trait anger, scores< x-s as the low trait anger.Thus there are 364 high trait anger people and 473 low trait anger people. According to this study's sample size required, we should take 236 people of the high trait anger, whose scores range from high to low, take 236 people of the low trait anger, whose scores range from low to high. By concentrating of blood, extracting DNA and genotyping and other steps, we exclude those who did not participate in blood concentrating and the lost blood samples in the extraction of DNA, and eventually we proceed with the statistical analysis of the data of 225 high trait anger people and 221 low trait anger people.2. Selection of gene polymorphisms sitesIn the light of relevant literature, we select tryptophan hydroxylase (TPH) gene A218C (rs1800532) sites, catecholamine-O-methyltransferase (COMT) gene V158M (rs4680) sites and monoamine oxidase A (MAOA) Gene 30bp-uVNTR sites for further research, which have been preliminarily studied by foreign countries. In addition, we select MAOA gene which the smallest gene and lest studied gene in the three neurotransmitter metabolism gene, and select tag SNP from the Haplotype map of human genome(HapMap) which are rs5906597, rs2235186, rs1181275 and rs5905613 whose tag SNPs can represent Han positive signal of the MAOA gene's SNPs. At the same time, we choose a functional SNP of MAOA gene, which is the site rs58524323 to proceed with exploratory research.3. DNA extraction(1) specimen collection and processingAfter the informed consent forms were approved and signed, we used vacuum blood collection to needle eligible subjects for vein blood 5ml (2% EDTA-Na 2200μl anticoagulant), and then we stored the blood samples at -20℃in the refrigerator for two weeks.(2) DNA extraction methodWe unfreezed -20℃cryopreservation blood samples at room temperature water, and put 600μl blood samples into the EP tube, and added equal volume of erythrocyte lysis buffer, and finally used 12 000 circle/min after mix well for centrifugation of blood samples. These procedures can ensure the absorption the supernatant which include lysis red blood cells. At last, we added leukocyte lysis buffer 450μl and broke sediments.Adding 40μl 10% SDS to centrifuge tube, we made the full mixing for 10min, and then added protease K10μl, and gently shaked them up by transferring centrifuge tube, and eventually bathed them in 37℃water overnight.We let the solution cool off, and the solution graduated into to room temperature. We added an equal volume of Tris saturated phenol, and placed the tube on the rotator for full mix 10min, so that the formation of two-phase emulsion can be achieved. Furthermore, we centrifugated it for 5min by 12 OOOcircle/min with a wide-bore pipette drawing the upper layer of water phase to a new centrifuge tube, added an equal volume of phenol/chloroform (volume ratio 1/1) 500μl, and mixed well to form a two-phase emulsion. And then we centrifugated it for 5min by 10 000 circle/min with wide-bore pipette drawing the upper aqueous layer to a new centrifuge tube, and added an equal volume of chloroform for a thorough mixing, and then centrifugated 10min by 12 000 circle/min.We transfered the water phase to new centrifuge tubes with a wide mouth pipette, and added 1/10 volume 3mol/L of NaCl and 800μl cold ethanol to the aqueous phase, and gently mixed them by reversing the centrifuge tube. Furthermore, we got precipitated DNA to 12000 circle/min for 5min's centrifugation. And then we used 70% cold ethanol to re-suspend DNA precipitation, and centrifugated it for 10min by 12 000circle/min, and finally discarded supernatant and repeated washing three times. The DNA precipitation should be dried and dissolved in appropriate amount of sterile water, storing at -20℃for standby application.4. Genotyping(1) PCR amplified fragmentGenomic DNA as template, respectively using the following primers PCR amplified purpose fragments. Genomic DNA sequence required by Primer design were from the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). All primers were designed using Primer Premier 5.0 software. Primer Design and Synthesis were accomplished by Biological Engineering limited company of ShangHai Jierui. The name, sequence (5' -3'), amplified product length of wait for detect polymorphic locus' PCR amplification primer are as follows.rs1800532:upstream primer F GCATTTAGAATGGTACCTGGC downstream primer R CACCACTCGATGCAACATTTG Amplified product length 231bprs4680:upstream primer F TACTGTGGCTACTCAGCTGTG downstream primer R TTCAGTGAACGTGGTGTGAAC Amplified product length 240bprs5906957:upstream primer F CAGATTACTAGAGTAGGCTCC downstream primer R GGTTACAGAGGTTATTGGCAG Amplified product length 230bprs2235186:upstream primer F AGAATGAAGCTGGAGAGAGAG downstream primer R TTGAATAGGAGGTCACCTGTC Amplified product length 233bprs1181275:upstream primer F CTTCACTTCCATTCCTACTCC downstream primer R AAGTAGTAAAATGAAGGTATG Amplified product length 190bprs5905613:upstream primer F CCACAATAGATAACCTTGGGC downstream primer R CCTGGGCCAAAAATGCTATTC Amplified product length 222bprs58524323:upstream primer F CATGACATTCTCTGACTCCTG downstream primer R CAGAACAGACACATACACACC Amplified product length 229bpMAOA基因30bp-uVNTR: upstream primer F FAM-AGCACGCGTGCCTCAGCCTCCTTCCCCGGC downstream primer R CCGAGATTCGGCGGGCCCTCCGCCTTGCGC Amplified product length 140-230bpPCR reaction system:template DNA1μl,10 X PCR buffer 1.5μl, MgC12 (25mM) 1.5μl, dNTP (10mM) 0.3μl, Taq enzyme 1.25U, each primer 0.25μl, make up the volume with deionized water to 25μl. PCR reaction conditions:94℃fore-denaturation for 2 minutes; 94℃denaturation for 15 seconds,60℃annealing for 15 seconds,72℃extend for 30 seconds,35 cycles; 72℃extend for 3 minutes.When amplification was accomplished, use 1.2% agarose gel electrophoresis to obtain the purpose of DNA fragment.(2) SNP loci ligase detection reactionDesign two left end of the probe(length difference 3bp) for each locus which were used to identify two different bases, and design right end of common probe which with fluorescence (FAM) for each locus, the difference length of the end product were the difference length between the left end of the probe. LDR probe were designed by Biological Engineering limited company of ShangHai Jierui.The name, sequence (5' -3')and product length of the probes are as follows.rs1800532 Left end of the probe TA:TATTAATTGACAACCTATTACGTGA Left end of the probe TC:TTTTATTAATTGACAACCTATTACGTGC Right common probe:P-TAGCTGCTATTCTGAGCATAGGGAA-FAM The size of the product are connected:50/A and 53/C;rs4680 Left end of the probe TA:TTTTCAGCGGATGGTGGATTTCGCAGGCA Left end of the probe TG:TTTTTTTCAGCGGATGGTGGATTTCGCAGGCG Right common probe:P-TGAAGGACAAGGTGTGCATGCCTGATTT-FAM The size of the product are connected:57/A和60/G;rs5906957 Left end of the probe TA:TTTTTTTTTCAGATTTTAGCATTTCCCTCCTCA Left end of the probe TG:TTTTTTTTTTTTCAGATTTTAGCATTTCCCTCCTCG Right common probe:P-AGACCTTCCAACGGCTCCCCTTCTCTTTTTT-FAM The size of the product are connected:64/A和67/G;rs2235186 Left end of the probe TC:TCAGAAAGAAAGGGCAGCTCTTAAG Left end of the probe TT:TTTTCAGAAAGAAAGGGCAGCTCTTAAA Right common probe:P-ATAAACAGCTGTAACCTGATCATTC-FAM The size of the product are connected:50/C和53/T;rs1181275 Left end of the probe TC:TTTTCATTTTCATTCATTTCTCCTTATAC Left end of the probe TT:TTTTTTTCATTTTCATTCATTTCTCCTTATAT Right common probe:P-GATTTATCCTTCCTATATATTTTTGTTT-FAM The size of the product are connected:57/C和60/T;rs5905613 Left end of the probe TC:TTTTTTTTTACCAAATTCCTCACTATCACAGGC Left end of the probe TT:TTTTTTTTTTTTACCAAATTCCTCACTATCACAGGT Right common probe:P-TGTACCATTTGTACTTGAGCCAGCATTTTTT-FAM The size of the product are connected:64/C和67/Trs58524323 Left end of the probe TA:TTTTTTTTTTTTATATTCACAAAAAGATAAGCTAACT Left end of the probe TG:TTTTTTTTTTTTTTTATATTCACAAAAAGATAAGCTAACC Right common probe:P-GCCTAGCAGTCCTGTTCATAGAACATTTTTTTTT-FAM The size of the product are connected:71/A和74/G10μl connection system:PCR product 3μl,10×Taq DNA ligase buffer 1μl, Taq DNA ligase5U, every specific LDR probe 0.1pmol, make up the volume with deionized water to 10μL. Connect reaction parameters:94℃denaturation for 30 seconds,60℃annealing and connect 3 minutes,20 cycles. When reaction was accomplished,4℃stored for later use.(3) Scanning the reaction products and reading the resultsThe seven SNP polymorphisms connection reaction products and VNTR polymorphisms' PCR product were taken 1μl, add 10μl of sample buffer (has already mixed with Marker),95℃denaturation 3 minutes, ice water bath immediately. scan reaction products by ABI 3730XL sequenator, according to the gap between position of the purpose peak and the Marker to read the results.5. Statistical analysisData were analyzed by SPSS13.0. qualitative data described by the frequency index, group comparison using chi-square test; the score of different genotypes described by the mean score plus or minus standard deviation (x±s), and carry out the single factor analysis of variance; correlation analysis using linear correlation, Pearson correlation coefficients were calculated. All statistical tests were used two-sided test, test level a=0.05, P<0.05 was considered statistically significant difference.Results:1. We make a comparison of frequency distribution of genotype and allele of 8 gene polymorphic locus of high and low trait anger groups:the difference was not statistically significant (P>0.05).2. The analysis of scores of the anger expression of 8 gene polymorphism locus'genotype groups shows:in high trait anger group, with regard to each genotype of the TPH gene A218C locus, the scores of anger expression-out are significantly (F=1=3.252,P=0.041), female scores of anger expression are significantly (F=6.668, P=0.002), male scores of anger expression-in are significantly (F=4.693, P=0.012); In terms of genotype groups of the rest gene polymorphisms locus, anger expression, anger expression-out and anger expression-in are no significant difference in scores (P>0.05). In low trait anger group, with regard to each genotype of the TPH gene A218C locus, the scores of anger expression-in are significantly (F=3.113, P=0.046); According to genotype groups of the rest gene polymorphisms locus, anger expression, anger expression-out and anger expression-in are no significant difference in scores (P>0.05).3. The analysis of scores of the anger control of 8 gene polymorphism locus' genotype groups shows:in high trait anger group, at genotypes of the TPH gene A218C locus, male scores of anger control-out are significantly (F =3.551,P=0.034), but in terms of the rest gene polymorphisms locus' different genotype groups, anger control, anger control-out and anger control-in are no significant difference in scores (P>0.05). In low trait anger group, at genotypes of the TPH gene A218C locus, and the scores of anger control are significantly (F=5.227,P=0.006), so are the scores of anger control-out (F=5.943, P=0.003) and the scores of anger control-in (F=4.104, P=0.018) and female scores of anger control-out (F=3.527,P=0.032). At genotypes of locus rs2235186 of MAOA gene, female scores of anger control-out are significantly (F=3.383,P=0.037), but in terms of the rest gene polymorphisms locus' different genotype groups, anger control, anger control-out and anger control-in are no significant difference in scores (P >0.05).4. The correlations between trait anger, anger expression and anger control in high and low trait anger groups tell us that trait anger and anger expression-out are positively correlated 0=0.493, P<0.01。r=0.377, P< 0.01) Whether the two groups are stratified by sex; and anger expression and anger expression-out, anger expression and anger expression-in are correlated (r=0.521,P<0.01; r=0.751, P<0.01。r=0.393,P<0.01; r=0.885, P<0.01). In addition, anger control and anger control-out, anger control and anger control-in are positively correlated (r=0.940,P<0.01; r=0.952, P<0.01。r=0.952,P<0.01; r=0.954,P<0.01); and anger control-out and anger control-in are positively correlated (r=0.791,P<0.01。r=0.816,P<0.01), while anger expression-out and anger control, anger expression-out and anger control-out, anger expression-out and anger control-in are negatively correlated (r=-0.336, P<0.01; r=-0.391, P<0.01; r=-0.252, P<0.01。r=-0.305,P<0.01; r=-0.351,P<0.01; r=-0.231,P<0.01)Conclusion:1. TPH gene A218C polymorphism is related with the following anger emotion trait of normal college students of the high trait anger in our country:anger expression-out traits, female anger expression traits, male anger expression-in traits and anger control-out traits. The polymorphism is concerned with the following anger emotion trait of normal college students of the low trait anger in our country:anger expression-in traits, anger control traits, anger control-out traits, anger control-in traits and female anger control-out traits.2. MAOA gene tag SNP rs2235186 is related with female anger control-out traits of normal college students of the low trait anger in our country.3. COMT gene V158M locus polymorphism and MAOA gene 30bp-uVNTR, rs1181275, rs5906957, rs5905613 and rs58524323 do not have relations with anger emotion traits of normal college students in our country.4. The following relationships can be found at either men or women in various dimensions of anger emotion traits of high and low trait anger groups: trait anger and anger expression-out trait are positively correlated; anger expression trait and anger expression-out trait, anger expression trait and anger expression-in trait are positively correlated, anger control trait and anger control-out trait, anger control trait and anger control-in trait are positively correlated, anger control-out trait and anger control-in trait are positively correlated. While anger expression-out trait and anger control trait, anger expression-out trait and anger control-out trait, anger expression-out trait and anger control-in trait are negatively correlated.