The Clinical And Experimental Research On The CD4～+CD25～+ Regulatory T Cells And Leukemia

Accumulating evidences show that many tumor associated antigens expressed on the normal cells and not the product of gene mutation and indicate the tumor immunity is a autoimmunity to some extent. CD4⁺CD25⁺regulatory T cells (CD4⁺CD25⁺Treg) can suppress the immune response to self and non-self antigen in active way and contribute to the maitainance for self-immune tolerance. So CD4⁺CD25⁺Treg may suppress the tumor immunity. CD4⁺CD25⁺ Treg provided a new way to study the relationship between the progress of tumor and immune suppression.In 1995 Sakaguchi et al were the first to found that a subset of CD4⁺ lymphocytes in peripheral blood of normal mice highly expressed the CD25(IL-2R-a) and lowly expressed the CD45RO,which constitute 5-10% of peripheral CD4⁺T cells and reffered as to CD4⁺CD25⁺Treg. The CD4⁺CD25⁺Treg express CD4,CD25(IL-2Ra), cytotoxic T lymphocyte associated protein 4(CTLA-4), glucocorticoid induced TNFR-relatde protein(GITR) and Forkhead/winged helix transcription factor(Foxp3).In 2003 Rudensky et al show that the Foxp3 is specificly expressed in the CD4⁺CD25⁺Treg and is essencial for the development and suppression function of the CD4⁺CD25⁺Treg cells.The research concerning the specific marker of CD4⁺CD25⁺ Treg cells-Foxp3 initiated recen -tly.Because the fluorescent monoclonal antibody(McAb) of Foxp3 was exploited and sold by American eBioscience compary in the end of 2004.So many researchers tested the CD4 and CD25 with flow cytometer and detected the Foxp3 mRNA with RT-PCR.But the levels of Foxp3 mRNA does not veritably reflect their protein level.So our experiment instantaneously test the CD4 ,CD25 and Foxp3 with corresponding fluorescent antibody in peripheral blood lymphocyte of leukemia patients and can reflect the protein level of Foxp3 and identify the change of Foxp3⁺ CD4⁺CD25⁺Treg in leukemia patients further.Accumulating evidences show CD4⁺CD25⁺Treg protect the host from autoimmune disease by suppressing self-reactive cells.As such, Treg cells may also block autitumor immune respons -es. CD4⁺CD25⁺Treg can actively inhibit the antitumor immunity of CD8⁺T cells,CD4⁺T cells and dendritic cells(DCs).Particularly in the context of cancer, Treg cells frequencies and function are importment because increased numbers might favor tumor development or growth and influence the course of the disease. Wolf and Ormandy et al reported that percentage of CD4⁺ CD25⁺Treg cells in total CD4⁺T cells increased in peripheral blood and tumor site in kinds of cancer patients,which contribute to tumor growth and decrease the cancer patients' survival rate.The studies about CD4⁺CD25⁺ Treg cells were concentrated in soild tumors and have been conducted only recently in hematologic malignancies .We just indexed one article about the CD4⁺CD25⁺ Treg cells in acute leukem -ia . That is Wang X et al "Increased population of CD4(+)CD25(high) regulatory T cells with their higher apoptotic and proliferating status in peripheral blood of acute myeloid leukemia patients".Our experiment will test the change of CD4⁺CD25⁺ Treg in acute leukemia patients and illuminate the relationship between CD4⁺CD25⁺ Treg and leukemia.The data established the concept of increased CD4⁺CD25⁺Treg cells in peripheral blood,lymphoid node and tumor sites in cancer patients.However,little is known about the mechanisms leading to this increase.Can the increased numbers of CD4⁺CD25⁺Treg cells result in the development of tumor or the tumor induce the increase of CD4⁺CD25⁺Treg cells.Leukemia is a hematologic neoplasm in which malignant cells are present in the born marrow and the blood.The traditional treatment contains the combination chemotherapy,radiation therapy and bone marrow transplantation.But these traditional therapy also bring much complication and the risk of suffering the another cancer and the relapse rate is very higher.So the immunotherapy became the hot spot for the leukemia treatment.But the effect of antigen specific immunotherapy was anything but satisfactory,because the tumor cells may escape from the immune surveillance through some kind of mechanism. CD4⁺CD25⁺ Treg can suppress tumor specific immune response and make the tumor cells grow and metabasis easily. The investigation for the immunocyte in leukemia patients will benefit to learn the mechanism of invasion and metastasis of tumor and explore the new treatment.Currently a number of questions are under intense investigation about between the acute leukemia and CD4⁺CD25⁺ Treg:How does alter the number of Foxp3⁺CD4⁺CD25⁺ Treg cells,especially the expression level of Foxp3 is not reported in leukemia patients.If the tumor can induce the CD4⁺CD25⁺ Treg cells proliferation and result in the failure of antitumor immunity.Based on the above hypothesis and objective,we drew up the research content:To test the change of CD4⁺CD25⁺ Treg in peripheral blood of acute leukemia patients; To explore if the tumor can induce the up-regulation of CD4⁺CD25⁺Treg by the experiment in vitro and in vivo with mice.This study aimed to approach the negative regulatory factors and the mechanism of the development in leukemia and look for the new way for the immunotherapy of leukemia ultimately.Partâ… :Test and its significance of CD4⁺CD25⁺regulatory T cells inleukemia patientsPurpose:To analyze the change of CD4⁺CD25⁺ Treg in peripheral blood lymphocyte of leukemia patients and to investigate their significance in the leukemia progress mechanism. Methods:We collected 32 leukemia patients in the second hospital of shanxi medical university from September 2005 to May 2006.All of them were first invasion and not receive the chemotherapy.Amone which had 20 male, 12 famale,the mean age of the leukemia patients was 53.6 .These leukemia patients make a definite diagnosis by clinical symptom,bone marrow cell and immunity typing.The corresponding healthy controls come from the health examination centre.All of 16 ones have 10 male and 6 famale. The mean age is 48.2.The frequency of CD4⁺CD25⁺ Treg in the peripheral blood(PB) was determined by flow cytometry.The method according to the directions of human regulatory T cell staining kit(eBioscience):Peripheral blood mononuclear cells(PBMC) were obtained using Ficoll/Hypaque density centrifugation.100μl PBMC were stained with FITC-conjugated anti-human CD4 and APC-conjugated anti-human CD25 antibodies for the surface markers.Intracellular staining was performed with PE-conjugated anti-human Foxp3 antibody.The samples were analyzed on a FACScalibur flow cytometer. The serum level of TGF-βand IL-10 was measured by the ELISA method.Correlation analysis between the proportion of CD4⁺CD25⁺Treg and the level of TGF-βand IL-10 was done in leukemia patients.The data were summarized as the mean±standard error.Statistical significance was accepted at the P<0.05 level.All the statistical analysis were performed using the SPSS statistical software package.Result:The mean proportion of CD4⁺CD25⁺ Treg of all CD4⁺T cells in acute leukemia patients was significantly higher than that of the normal control (3.96±1.86) % versus (2.08±1.63)% (P<0.01).We acquire the proportion of CD4⁺CD25⁺Foxp3⁺Treg of all CD4⁺T cells in acute leukemia patients is notably higher when compare with the normal control first time(3.22±1.01)% versus(0.83±0.72)%(P<0.01).These data indicate that the CD4⁺CD25⁺Treg which expressed higher levels of Foxp3 is one of the reasons for the failure of antitumor immunity. In addition,we accidentally discover that the proportion of CD4⁺ Foxp3⁺T cells increased notablely in leukemia patients compare with the normal control (14.9±2.92) % versus (5.68±1.21)% (P<0.001).But the relationship between the CD4⁺ Foxp3⁺T cells and CD4⁺CD25⁺ Treg cells needs further research.A position correlation is found between the number of CD4⁺CD25⁺Treg and the serum level of TGF-βand IL-10.Conclusion:â‘ We provided the evidence for an increased pool of CD4⁺CD25⁺ Treg in the peripheral blood in acute leukemia patients.These data suggest not only the increased number of this cell population correlate with the failure of antitumor immunity and make the tumor grow and metastasize easily but also down-regulated the number and function will enhance anti-tumor immunity. ?we found both the TGF-βand IL-10 played a key role for the immunosuppression in CD4⁺CD25⁺ Treg.These investigation will provide the beneficial enlightenment for the immunoregulation targeting CD4⁺CD25⁺Treg. Partâ…¡:The experimental research about the leukemia cells inducing the proliferation of CD4⁺CD25⁺regulatory T cells in vitro and in micePurpose:This study was aimed to explore if the tumor induced the proliferation of CD4⁺CD25⁺Treg by the experiment in vitro and in vivo with mice.For one thing we evaluate the change of CD4⁺CD25⁺ Treg cells in leukemia mice models.For another we survey how the supernatant from cultured leukemia cell line FBL3 affect the CD4⁺CD25⁺Treg cells. This study investigate the mechanism of CD4⁺CD25⁺Treg increased in the onset of leukemia .We expect to provide beneficial data for the recongnition and regulatory of CD4⁺CD25⁺ Treg cells in the development of tumor and to supply experiment evidence for the diagnosis and treatment in leukemia.Method:â‘ experiment in vivo. The erithroleukemic cell line FBL₃ origin from the C57BL/6 mice were abundantly cultured in RPMI 1640 medium supplemented with 10% fetal calf serum,5%CO2,37?,saturate humidity.The cells were collected and washed three times with PBS.6 to 8 weeks C57BL/6 mice(n=44) were randomly grouped.The FBL3 cells were resuspended in PBS and inoculated at abdominal cavity with 2×10⁷ live tumor cells per mouse to build the leukemia beared mice(n=22).While the control group(n=22) were inoculated PBS 1ml per mouse 3 at abdominal cavity.After the model succeed we take the tumor tissue,liver,spleen and kidney to do pathological section. CD4⁺CD25⁺subset in peripheral blood and spleen lymphocytes were analyzed by floe cytometry:Mouse peripheral blood was collected from orbital plexus and put in a anticoagulation tube.Then we took the spleen and tumor tissue and prepared the single-cell suspensions of splenocytes and tumor cells by grinding them gently with steel cage of 100 meshes and suspended the cells in PBS.The samples were stained with FITC-conjugated anti-mouse CD4 and PE-conjugated anti-mouse CD25 antibodies at 4? for 30 minutes.Then the CD4⁺CD25⁺subset were analyzed on a FACScalibur flow cytometer.In addition,we test the gene expression level of the specific marker Foxp3 using RT-PCR:The sequence of Foxp3 primer: 5'CAGCTGCC TACAGTGCCCCTAG 3'(upstream) and 5' CATTTGCCAGCAGTGGGTAG 3'(do -wnstream).The sequence of reference primer HPRT:5' GGTGAAGGTCGGTGTCA ACG 3'(upstream) and 5' CAAAGTTGTCATGGATGACC 3'. The length of Foxp3 is 340bp.We obtain the spleen and tumor tissue sterile after execute the mice.Total RNA were extracted with Trizol and obtained the gene product by reverse transcription polymerase chain raction(RT-PCR).The control groug mice were test the correspond -ding index.â‘¡experiment in vitro.To survey how the supernatant from cultured leukemia cell line FBL3 affect the CD4⁺CD25⁺ Treg cells in normal mice.At first,we prepared the supernatant from cultured cells-line FBL3.Then the single-cell suspensions of splenocytes were prepared sterile after execute the mice.The experiment separated four groups.The first group was black control:0.5ml mouse spleen lymphocytes+1ml RPMI 1640 medium;The second group:0.5ml mouse spleen lymphocytes+lml the supernatant from cultured FBL₃ cells;The third group:0.5ml mouse spleen lymphocytes+CD₃ McAb(the final concentration was 2μg/ml)+ 1ml RPMI 1640 medium;The forth group:0.5ml mouse spleen lymphocytes+ CD₃ McAb(the final concentration was 2μg/ml)+0.5ml the supernatant from cultured FBL₃ cells+ 0.5ml RPMI 1640 medium.After cultured 72 hours CD4⁺CD25⁺subset were analyzed by flow cytometry and the gene expression level of the specific marker Foxp3 were tested by RT-PCR.The experiment repeated three times. The statistical analysis were the same as the Partâ… .Result:The proportion of CD4⁺CD25⁺ Treg cells in peripheral blood lymphocytes and spleen lymphocytes in normal mice were respectively(4.15±1.17)% and (3.82±1.07)%,which is in accordance with the results reported by others.The distribution of CD4⁺CD25⁺Treg cells had the significant variance among the peripheral blood, spleen and tumor tissue,in which the proportion of CD4⁺CD25⁺Treg cells of all lymphocytes in spleen was highest and that in tumor tissue was lowest.No difference was observed in the proportion of CD4⁺CD25⁺ Treg cells in peripheral blood lymphocytes between tumor bearing mice and normal mice.While the proportion of CD4⁺CD25⁺ Treg cells in spleen lymphocytes in tumor bearing mice was a significant increase as compared with normal mice ( (16.2±0.56)% versus (3.80±1.07)% ,P<0.01).At the same time there was a notable increase in the proportion of CD4⁺CD25⁺Treg cells of all CD4⁺T cells in tumor bearing mice than that in the normal control too((25.48±3.26)% versus(0.23±2.07)%,P<0.05).In addition, the proportion of CD4⁺CD25⁺Treg cells of all CD4⁺ T cells in spleen was higher than that in the peripheral blood both in tumor bearing mice and normal mice.The results measured by RT-PCR showed that the expression of Foxp3 mRNA in the spleen of leukemia-beared mice is significantly higher than that of the control. The expression of Foxp3 in tumor tissues was very low, that was consistented with the the percentages of CD4⁺CD25⁺ subset by FCM. In vitro experiment indicated the supernatant derived from FBL3 can upregulate the proportion of CD4⁺CD25⁺ Treg cells in normal mouse spleen lymphocytes. Moreover when added the CD3 McAb and FBL3 supernatant also increased the number of CD4⁺CD25⁺ Treg cells.The level of corresponding Foxp3 mRNA also increased. These data suggested that in the supernatant may occur immune regulatory factors which upregulated the number of CD4⁺CD25⁺ Treg cells.Conclusions: The distribution of CD4⁺CD25⁺ subset in spleen of leukemia-bearing mice was significantly higher than that in normal mice. It revealed that the downregulation of antitumor immunity may be closely related to CD4⁺CD25⁺ subset.The distribution of CD4⁺ CD25⁺ Treg cells had the significant variance among the peripheral blood, spleen and tumor tissue,in which the proportion of CD4⁺CD25⁺Treg cells of all lymphocytes in spleen was highest and that in tumor tissue was lowestIn the same time the levels Foxp3 mRNA in leukemia -bearing mice is significantly higher than that of the control.In vitro experiment indicated that the supernatant may occur immune regulatory factors which increased the number of CD4⁺CD25⁺ Treg cells.Our study certified the tumor can induce the up-regulation of CD4⁺CD25⁺ Treg by the experiment in vitro and in vivo with mice.These data provide the reliable evidence both for the research about the mechanisms leading to the increase of CD4⁺CD25⁺Treg in human cancer and for understanding thoroughly the role of CD4⁺CD25⁺ Treg in the development of tumor,the mechanism of tumorigenesis,the improvement of the treatment and prevention for cancer.In a word,these results indicateâ‘ The increased number of CD4⁺CD25⁺Treg may damage the immune function in acute leukemia patients.â‘¡the leukemic cells and their solubility factors can induce the increase of CD4⁺CD25⁺ Treg and indicate the tumorigenesis can facilitate proliferation of CD4⁺CD25⁺Treg.These data can not only explain preferably the reason for the dysfunction of the immune system and poor prognosis in leukemia patients but also show that CD4⁺CD25⁺ Treg may become the new target of immunotherapy for cancer. For one thing, Depletion of CD4⁺CD25⁺ Treg or downregulation its suppression function will make for the enhancement of the effect of tumor immunotherapy.For another,The curative effect of vaccine can improve by downregulation the suppression function of CD4⁺CD25⁺Treg.Our experiment reveal the mechanisms for the dysfunction of the immune system in leukemia patients.These results established the foundation for the researchment about the pathogenesis and the tumor immunotherapy in clinical leukemia.