Study On The Effect Of Bcl-2 On Apoptosis Of Human Bladder Cancer Cell Induced By Chemotherapeutic Drugs And The Underlying Mechanism

ObjectiveMitogen myosin C ( MMC) is characterized by unobvious side effect, less cost and strong antitumor effect ,so it is widely used for malignant tumors. Previous studies indicated it can inhibit the DNA synthesis through crossing over with DNA and breaking single strand DNA after its activation by enzymes. Now, it is suggested apoptosis may be the cause of antitumor effect induced by MMC. Although, a lot of studies have suggested the mechanism of apoptosis induced by MMC, the exact mechanism underlying apoptosis remains unclear now. Recent studies proved mitochondria may be an important regulator .for apoptosis. The role of mitochondria in the apoptosis needs further study. In the current study, we detected localization of apoptosis - promoting factor cytochrome C in BIU -87 cell to elucidate the mechanism underlying apoptosis induced by MMC. Bcl -2 ( B cell lymphoma leukemia - 2) is an oncogene encoding glycoprotein of 26KD. It can inhibit apoptosis hence promoting survival. Recent studies suggested Bcl - 2 is overexpressed in bladder cancer cell resistant to chemotherapeutic drugs. However, it remains unclear the pathways underlying Bcl -2 related drug resistance.It is indicated mitochondria is involved in apoptosis. Bcl - 2 can suppress the release of apoptosis promoting factors through modulating the function of mitochondria. Recent studies found many factors can induce apoptosis through mi-tocondria in Bcl -2 independent pathways. Effect of Bcl -2 on apoptosis varied greatly in the different tissue type under the same stimulation. At present, further study is needed to probe the role of mitochondria in chemotherapeutic drug - induced apoptosis and whether Bcl - 2 can inhibit apoptosis by regulating function of mitochondria. In the current study, we studied the effect of chemo-therapeutic drug on apoptosis after Bcl - 2 was transfected into bladder cancer cell BIU - 87 and investigated the underlying mechanism in view of movement of apoptosis promoting factors within cell.Materials and methods1. Construction of pcDNA3.1 ( + ) /Bcl - 2Bcl -2cDNA( 847bp) was inserted into eukaryotic expression vector pcD-NA3.1 ( + ) , the resulting vector was confirmed by sequencing.2. TransfectionTransfection was performed according to manuscript of Lipofectamine 2000. pcDNA3.1 ( + ) and resulting pcDNA3. 1 ( + )/Bcl -2 were transfected into BIU -87 cell and the resulted cells were named BIU -87/neo and BIU -87/Bcl- 2.3. Detection of expression of Bcl -2 by RT - PCRTotal RNA was isolated with Trizol and RT - PCR was performed according to kit ( Upstream primer: 5'- GCAGAGGGGCTACGAGTGG - 3'; Downstream primer:5' - TCAAACAGAGGCCGCATG - 3', 561bp).β- actin was amplified for control ( upstream primer: 5 ' - GAGCTACGAGCTGCCTGACG - 3 '; downstream primer; 5 ' - CTCCTGCTTGCTGATCCACAT - 3 ' , 370bp). PCR product was detected on 2% agarose gel and stained with Genefinder. Image was obtained under UV light.4. GroupingThe cells were divided into 3 groups; BIU - 87, BIU - 87/neo, and BIU -87/Bcl-2.5.MTTBIU -87 (1×10⁵个/mL) was plated onto 96 - well plate, 100μL/well. Medium was discarded 24 hours after plating. 100μL serum free medium containing 16,32,64,128μg/mL MMC was added into each well, 4 paralleling wells for each concentration were set. Well with serum free medium was control. 10μL containing 5g/L MTT was added 24 hours after culture and cultured for further 4hours under 37℃.Then, supernatant was discarded and 100μL DMSO was added. Shaking was done to dissolve the crystal. A490 of 490nm was detected with Automatic enzyme - detector to calculate survival rate ( survival rate = A490 of study group/A490 of control group).6. Apoptosis rate detection by FCMBIU - 87 cell was plated onto culture flask. Serum free medium containing 0,16,32,64,128/μg/mL was added 24 hours after culture and cultured for another 24 hours. Cells were collected centrifugally and resuspended in 75% alcohol. Finally, cells were fixed 4℃overnight. Then cells were stained with PI for 30 min under 4℃.. FCM was run with parameter FL2 - A. Apoptosis rate was denoted as ration between subdiploid cells and number of total cells appeared before G₀/G₁.7. Observation of cell morphology by AO stainingBIU -87 cell was plated onto culture flask,with a concentration of 64μg/ mL. MMC was added to treat cells for 24hours. Cells were resuspended (1×10⁷个/mL) , stained with AO and observed under microscope.8. Detection of subcellular localization of Cytochrome C by western blotting Mitochondria/cytoplasm protein was extracted according to kit and quantified with Bradford Assay. 40μg protein was loaded for SDS - PAGE. Protein was transferred onto nitrocellulose membrane, incubated with the primary antibody, and developed. Strength of band was scanned. Protein concentration was denoted as ration between band of interest and internal control.9. Detection of activity of Caspase -31 10⁶MMC -treated cells were collected for activity assay. A405 of 405nm was used to denote the activity of capase -3. 10. Statistical analysist or q test was used.ResultsDecreased survival rate of BIU - 87 was observed with MMC increases. Negative correlation between survival rate of BIU - 87 and MMC concentration was found (r= - 0.97, P < 0. 05). We observed the lower apoptosis rate ofBIU - 87. Apoptosis rate was increased gradually with MMC concentration enhanced. AO staining showed normal cell morphology, even yellow and green fluorescence of cytoplasm or red fluorescence due induced by RNA, and green nu-cleolus. Some cells showed contraction of chromatin, nucleus, and strong fluorescent particles relevant to apoptosis. Cyctochrome C showed reduced expression after MMC administration and cells with negative cytochrome C showed expression of cytochrome C after treatment. Caspase - 3 activity was enhanced after treatment.Sequencing confirmed the construction of pcDNA3. 1 ( + )/Bcl -2 . Sequence of Bcl - 2 was in accordant with sequence of Bcl - 2 recorded in Gene-bank (reference number: 179370). Expression of Bcl -2 in BIU -87/Bcl -2 group was enhanced by 2.2 and 2.1 fold compared with BIU - 87 and BIU - 87/ neo group, respectively. Survival rate of cells in BIU - 87/Bcl - 2 group was markedly higher than cells in BIU - 87 and BIU - 87/neo groups after 16 -128μg/ml of MMC treatment. IC₅₀ of MMC for cells in BIU -87/Bcl -2 group was enhanced by 15 folds compared with those in cells in BIU - 87 and BIU -87/neo groups. Apoptotic cells were observed in three groups after MMC administration. Rate of apoptosis of cells in BIU - 87/Bcl - 2 was significantly decreased compared with that in BIU -87 and BIU -87/neo groups. There was no difference in Caspase - 3 activity among cells in BIU - 87, BIU - 87/neo, and BIU - 87/Bcl - 2 under normal condition. The enhanced Caspase - 3 activity was observed and activation of Caspase - 3 of cells in BIU - 87/Bcl - 2 group suppressed after MMC treatment. There was no difference in concentration of cytochrome C among cells in BIU -87,BIU - 87/neo,and BIU -87/Bcl -2 under normal condition and we detected no expression of cytochrome C. After MMC treatment, cytochrome C was released into cytoplasm resulting in its increased concentration in cytoplasm in three groups. Cells of BIU - 87/Bcl - 2 group showed significant reduction in concentration of cytochrome C in cytoplasm and enhancement in mitochondria compared with those in BIU -87 and BIU -87/neo groups. Conclusion1. Chemotherapeutic drug MMC promotes apoptosis of bladder cancer cell by inducing release of cytochrome C by mitochondria and activating caspase -32. Mitochondria is the crossover point at which MMC promotes apoptosis of bladder cancer cell and Bcl -2 inhibits apoptosis.3. High expression of Bcl -2 can inhibit activation of caspase -3 through reducing release of cytochrome C by mitochondria , and hence suppression of MMC induced apoptosis and generation of drug resistance.